pOTB7D Information

pOTB7D Diagram

(Vector diagram drawn using PlasMapper.)

pOTB7D is derived from pOTB7 where a pair of oligos corresponding to gaattccactgtgtggcggccgccaccctgtgctcgag were annealed and ligated into the EcoRI and XhoI prepared pOTB7. This introduced two DraIII sites that allow for directional cloning of cDNA inserts that contain SfiI sites. cDNA inserts will have their 5' ends near the EcoRI site and the polyA tail/3' ends near the XhoI site.


  >pOTB7D polylinker:
                                                          SP6(52,72)>>> 
                                                          |
  1     CGTTAGAACGCGGCTACAATTAATACATAACCTTATGTATCATACACATACGATTTAGGT 60
        GCAATCTTGCGCCGATGTTAATTATGTATTGGAATACATAGTATGTGTATGCTAAATCCA

                          BamHI                          M13 forw.(111,127)>>>
                          |                              |
  61    GACACTATAGAACTCGAAGGATCCACAAGTTTGTACAAAAAAGCAGGCTTGTAAAACGAC 120
        CTGTGATATCTTGAGCTTCCTAGGTGTTCAAACATGTTTTTTCGTCCGAACATTTTGCTG

                        AvaII            StuI  BglI EcoRI    DraIII
                        |                |     |    |         |
  121   GGCCAGTAACTATAACGGTCCTAAGGTAGCGAGGCCTGGGTGGCgaattccactgtgtgg 180
        CCGGTCATTGATATTGCCAGGATTCCATCGCTCCGGACCCACCGCTTAAGGTGACACACC

                DraIII  XhoI 
                    |    |
  181   cggccgccaccctgtgctcgagGCATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATG 240
        GCCGGCGGTGGGACACGAGCTCCGTAGATACAGCCCACGCCTCTTTCTCCATTACTTTAC

          M13 rev(244,262)<<<                            BglII 
          |                                              |
  241   GCACATGGTCATAGCTGTTTCCTGACCCAGCTTTCTTGTACAAAGTGGTAGATCTGCCGG 300
        CGTGTACCAGTATCGACAAAGGACTGGGTCGAAAGAACATGTTTCACCATCTAGACGGCC

          T7(304,323)<<<                        HpaI 
          |                                     |
  301   TCTCCCTATAGTGAGTCGTATTAATTTCGATAAGCCAGGTTAACCTGCATTAATGAATCG 360
        AGAGGGATATCACTCAGCATAATTAAAGCTATTCGGTCCAATTGGACGTAATTACTTAGC






  >pOTB7D 1827 bases.
  CGTTAGAACGCGGCTACAATTAATACATAACCTTATGTATCATACACATACGATTTAGGT
  GACACTATAGAACTCGAAGGATCCACAAGTTTGTACAAAAAAGCAGGCTTGTAAAACGAC
  GGCCAGTAACTATAACGGTCCTAAGGTAGCGAGGCCTGGGTGGCgaattccactgtgtgg
  cggccgccaccctgtgctcgagGCATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATG
  GCACATGGTCATAGCTGTTTCCTGACCCAGCTTTCTTGTACAAAGTGGTAGATCTGCCGG
  TCTCCCTATAGTGAGTCGTATTAATTTCGATAAGCCAGGTTAACCTGCATTAATGAATCG
  GCTGCAGTACCCGGGAATTTAACCCGCCTAATGAGCGGGCTTTTTTTTGTGATCCAAAGG
  ATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACC
  GCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAAC
  TGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCA
  CCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGT
  GGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACC
  GGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCG
  AACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCC
  CGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCAC
  GAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCT
  CTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGC
  CAGCAACGCGGATCACAACAAAAAGCCCGCTCATTAGGCGGGCTAAATTCTCATGTTTGA
  CAGCTTATCATCGATAAGCTAGCGGCCGCTAGCTTTAATGAGTTATCGAGATTTTCAGGA
  GCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAA
  TGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAG
  ACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTT
  TATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAGTTCCGTATG
  GCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTC
  CATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAG
  TTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCT
  AAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGT
  TTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAA
  TATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTT
  TGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGG
  CAGGGCGGGGCGTAATTGGTACGTCGA


  >pOTB7D with linkers; 1853 bases.
  CGTTAGAACGCGGCTACAATTAATACATAACCTTATGTATCATACACATACGATTTAGGT
  GACACTATAGAACTCGAAGGATCCACAAGTTTGTACAAAAAAGCAGGCTTGTAAAACGAC
  GGCCAGTAACTATAACGGTCCTAAGGTAGCGAGGCCTGGGTGGCgaattccactgtcggc
  cctgcgtttgctggctttgatgaaa[5'-cDNA-3']catgtcggccgcctgtgctcgagGCATCTATGTCG
  GGTGCGGAGAAAGAGGTAATGAAATGGCACATGGTCATAGCTGTTTCCTGACCCAGCTTT
  CTTGTACAAAGTGGTAGATCTGCCGGTCTCCCTATAGTGAGTCGTATTAATTTCGATAAG
  CCAGGTTAACCTGCATTAATGAATCGGCTGCAGTACCCGGGAATTTAACCCGCCTAATGA
  GCGGGCTTTTTTTTGTGATCCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATC
  TGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAG
  CTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTT
  CTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATAC
  CTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACC
  GGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGT
  TCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGT
  GAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGC
  GGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTT
  TATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCA
  GGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGATCACAACAAAAAGCCCGCTCAT
  TAGGCGGGCTAAATTCTCATGTTTGACAGCTTATCATCGATAAGCTAGCGGCCGCTAGCT
  TTAATGAGTTATCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTG
  GATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGT
  CAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGA
  CCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGA
  TGAATGCTCATCCGGAGTTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATA
  GTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGA
  GTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTT
  ACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAG
  CCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCT
  TCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGC
  TGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATG
  AATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATTGGTACGTCGA