[an error occurred while processing this directive] BDGP: cDNA & EST FAQ

pOTB7D Information

pOTB7D Diagram (Vector diagram drawn using [PlasMapper](http://wishart.biology.ualberta.ca/PlasMapper/).)

pOTB7D is derived from pOTB7 where a pair of oligos corresponding to gaattccactgtgtggcggccgccaccctgtgctcgag were annealed and ligated into the EcoRI and XhoI prepared pOTB7. This introduced two DraIII sites that allow for directional cloning of cDNA inserts that contain SfiI sites. cDNA inserts will have their 5' ends near the EcoRI site and the polyA tail/3' ends near the XhoI site.

  >pOTB7D polylinker:

                          BamHI                          M13 forw.(111,127)>>>
                          |                              |

                        AvaII            StuI  BglI EcoRI    DraIII
                        |                |     |    |         |

                DraIII  XhoI 
                    |    |

          M13 rev(244,262)<<<                            BglII 
          |                                              |

          T7(304,323)<<<                        HpaI 
          |                                     |

  >pOTB7D 1827 bases.

  >pOTB7D with linkers; 1853 bases.