Selected Sequence features of Universal Proteomics Resources

loxP:
ATAACTTCGTATAGCATACATTATACGAAGTTAT

Splice Donor (SD; in red) and 6xHN epitope tag from pDNR-Dual vector:
CAG/GTAAGTGGTCATAATCATAATCATAATCATAATCATAATCACAAC
Note: We have observed cases (<0.05%) where the splice donor is CAG/GTGAGTGGTCATAATCATAATCATAATCATAATCATAATCACAAC

Splice Acceptor (SA):
CCACAG/C
Note: the splice site is indicated by the forward slash (/).

Forward PCR-cloning primer (for In-Fusion PCR cloning into pDNR-Dual vector)
5'-GAAGTTATCAGTCGAC[gene-specific-sequence]-3'

Reverse PCR-cloning primer (for In-Fusion PCR cloning into pDNR-Dual vector)
5'-ATGGTCTAGAAAGCTT[gene-specific-sequence]-3'