May 10-12, 2024: There is a planned power outage for the weekened of May 10-12. During this time the fruitfly.org and insitu.fruitfly.org servers will be inaccessible. We plan to have the servers back up sometime on May 12. We apologize for the inconvenience.

Selected Sequence features of Universal Proteomics Resources

loxP: ATAACTTCGTATAGCATACATTATACGAAGTTAT

Splice Donor (SD; in red) and 6xHN epitope tag from pDNR-Dual vector: CAG/GTAAGTGGTCATAATCATAATCATAATCATAATCATAATCACAAC Note: We have observed cases (<0.05%) where the splice donor is CAG/GTGAGTGGTCATAATCATAATCATAATCATAATCATAATCACAAC

Splice Acceptor (SA): CCACAG/C Note: the splice site is indicated by the forward slash (/).

Forward PCR-cloning primer (for In-Fusion PCR cloning into pDNR-Dual vector) 5'-GAAGTTATCAGTCGAC[gene-specific-sequence]-3'

Reverse PCR-cloning primer (for In-Fusion PCR cloning into pDNR-Dual vector) 5'-ATGGTCTAGAAAGCTT\[gene-specific-sequence\]-3'