[an error occurred while processing this directive] BDGP: Drosophila Proteomics Resource Collections

Selected Sequence features of Universal Proteomics Resources

loxP: ATAACTTCGTATAGCATACATTATACGAAGTTAT

Splice Donor (SD; in red) and 6xHN epitope tag from pDNR-Dual vector: CAG/GTAAGTGGTCATAATCATAATCATAATCATAATCATAATCACAAC Note: We have observed cases (<0.05%) where the splice donor is CAG/GTGAGTGGTCATAATCATAATCATAATCATAATCATAATCACAAC

Splice Acceptor (SA): CCACAG/C Note: the splice site is indicated by the forward slash (/).

Forward PCR-cloning primer (for In-Fusion PCR cloning into pDNR-Dual vector) 5'-GAAGTTATCAGTCGAC[gene-specific-sequence]-3'

Reverse PCR-cloning primer (for In-Fusion PCR cloning into pDNR-Dual vector) 5'-ATGGTCTAGAAAGCTT\[gene-specific-sequence\]-3'