[an error occurred while processing this directive] BDGP: 3rd Chromosome: Source Canton S vs Oregon R

Projects

3rd Chromosome: Source Canton S vs Oregon R


Click [HERE] to view Table Legend

STS Cytological
Location
Flanking
Sequence
Nucleotide
Position
CSiso3 ORiso3
Dm2958 61B GGTCAATCGA-GTTGCTGCCT 170R A 51/- G 51/-
Dm2467 61C TCTTTTTTTT-CCTGATTTTT 157InDel T 48/-
Dm0688 61D ACCGGAATTT-GGAGAGTTCC 132M C 56/56 A 51/48
61D GGACAAGAAT-TGGAATTAAG 186S C 56/- G 51/-
Dm3857 61E GCAGATACTC-ATCCTAGCCT 272R G 51/51 A 42/42
61E CGACCTCGTA-GTGGCGTTCT 371R A 51/- G 36/-
Dm0903 62A ACAGCGGACA-CGGACAACGG 140R A 40/19 G 40/17
62A CGGACAAGGC---GAATGGCAGG 158InDel AAT 56/25
62A GTGAGGGAGA--CCAGA_TC_A 233InDel AT 51/-
62A AGA__CCAGA-TC_AGAATCC 240W A 56/- T 48/-
62A __CCAGA_TC-AGAATCCAGA 243S G 51/- C 48/-
Dm1545 62B AGGGTTCCGA-GGCAAGCGCA 86W T 34/38 A 26/35
62B TTCTCGCGGC-TCGATTAACT 119Y C 45/56 T 56/56
62B TTAGCAAAAC-CAGAGTGTGG 131R G 46/42 A 46/40
62B TGGCCGTCGT-GACCTGGATA 149K G 40/51 T 40/40
62B ATAAGAAACT-CATTAATACA 210Y C 40/56 T 35/47
62B TTAATACAAA-AATACACCCT 223W A 56/46 T 42/26
Dm2527 62E TGGTGGCACT-TTTAGAGGCG 138R A 56/- G 37/-
Dm1756 62F ATACTAATGG-TGTGGGTGCC 12W T 46/- A 40/-
62F CCTGCCCCTT-AGAGCCTGAG 38Y T 45/- C 40/-
62F CGTAGCCACA-ACCACGACCT 80S G 35/- C 43/-
Dm3834 62F TTAAACTAAA-TACAATAAAA 111W T 45/42 A 56/42
Dm2200 63D TCTCCGCCGC-TTCCC_CCCT 186Y T 45/- C 45/36
63D CCGC_TTCCC-CCCTCGGTGG 192R G 51/- A 45/13
Dm2349 63D TTGAATATTC-GAATAATAGT 116R G 56/56 A 45/56
63D AAGCCCTATT-AT_TATGGGA 146K T 56/25 G 51/-
63D CCCTATT_AT-TATGGGAAAT 149W A 56/29 T 51/8
63D TATATATGGG-AATTCAGCAA 156InDel A 56/-
Dm2185 63E GCAGACATCC-ACCAGACATT 160R G 37/35 A 40/-
Dm2168 64C CTTCCCTCCC-TTCCCACTTC 185K G 40/32 T 56/4
Dm2086 64E COMPLEX
Dm3168 65A GGAATTTCTG-ACGAGGAGGA 204R G 40/- A 45/-
Dm0258 65C CCCTTGTTGC-CTTATTATAT 186K G 35/32 T 45/46
65C TGGTGCTGCT-TGTGCCACAC 234K G 35/- T 45/-
Dm2918 65E TTACTTCCTC-GGAGCGAATA 44S G 51/- C 42/-
Dm0936 65F AAGAAATGGC-TCCGCCGATC 169R G 40/33 A 42/40
65F AATGTGCCGC-AATGCGATGC 202W A 42/- T 37/-
Dm0925 66A TAAAACACAC-ATATACACAA 203W T 40/40 A 56/30
66A GAGACGTAAA-GTTACAATAT 241Y T 56/56 C 51/-
66A TGGAAAATAG-ATTCAATTAA 305W A 45/- T 45/-
Dm0926 66A CTTACCATTA-GG_TTTTATG 90R G 34/51 A 32/51
66A ACCATTA_GG-TTTTATGTTT 93R G 48/45 A 48/56
66A GAACCGCATC-AGAATCCTGC 141K G 51/42 T 51/37
66A CCTTCAGCTA-CCGGCATCCT 194R G G 39/34 A 40/35
Dm0927 66A CACATAAATC-TCAGCGAAGA 63S C -/40 G 9/37
66A CGAAGAAAGA--------GAAAGAGAGA 78InDel CAGAGAGA 29/56
66A GCATGGACCG--AAAAAGAACC 161InDel AA 51/27
Dm2716 66A CATCCACGGT-ATCCTGCGGC 135R A 27/- G 56/-
66A CGGAGTCCGC-AGTCCGGAAA 180M C 25/- A 40/-
Dm0913 66B AGGAGCATTG------CCACGACGGA 271InDel ACTTTG 45/21
Dm0929 67A CAAACTAATG-GTTT_GTGGT 63Y C 16/56 T 8/56
67A TAATG_GTTT-GTGGTACGAA 68W T 5/42 A 6/40
Dm0930 67A ACAATAGGAT-AGATTA_AAA 82R A 35/51 G 56/42
67A GAT_AGATTA-AAAAGGATTT 89Y C 40/44 T 40/56
67A ATAATTTTCT-AT___AGTTA 125Y T 51/56 C 56/44
67A ATTTTCT_AT---AGTTATATAA 128InDel TAT 43/37
67A AAGCGTATTT-AATTAT_CAT 150S G 56/40 C 56/56
67A TTT_AATTAT-CATATCAACT 157W A 40/56 T 46/51
67A AGCATATATT-ACGTATTTTT 188W T 45/56 A 39/46
67A AGCAGGGCCT-CTTTATAGAT 223W A 40/- T 56/-
Dm4015 67A GTAACTGAAA-TGCTAGTTGC 56R A 56/56 G 56/43
67A CTCAAATTTC-ATATCTTGAA 90R G 42/40 A 51/56
67A TGGCACTCTT-AAGACTCCCA 122K T 44/45 G 50/42
67A CCATCCCTAA-CAATCGATTG 140S C 40/37 G 56/29
67A GGTTAGCTGC-TGCCATCTCT 164W A 40/35 T 35/24
Dm0482 67B GGTAACAAGG-AATATGATAT 164M A 56/24 C 56/-
67B TATAAATTAG-AAATTCAATA 182R G 45/27 A 45/-
Dm0513 67B GGTGGTCCTG-GGAACGCCCA 109S G 51/56 C 51/40
67B CGGCGGAGAG-GAGCGGACGG 202M A 56/6 C 40/-
Dm0947 67B AATGCGATAA-CAAGTACG_A 236S C 28/- G 40/42
67B A_CAAGTACG-ACATACA___ 245S C 42/- G 39/42
67B CG_ACATACA---ATGTACATAC 252InDel TACATATGT 51/-
67B TCCGCCCCAT-ACTACAATGG 368W A 40/- T 51/-
Dm4030 67B CAGACAGAGA-AGCGATAGCT 133K G 34/29 T 21/30
Dm4039 67B CGGCGTCGCT-GCAAAGCCCG 795R A 29/14 G 45/42
67B GCCCGCCAAT-ACTTACCGAA 811InDel A 51/16
67B TGAATACCCC-GGATCGGATT 849R A 35/22 G 56/11
Dm0963 67C CCGTTGAAGT-CGGCACTTAC 81R G 56/37 A 42/40
Dm2202 67C AAGAACATTT-CCGAATGTAA 93R A 40/- G 42/-
Dm3377 67D ATTCGGCCTG-GTCAG_GGCT 169R A 51/- G 56/-
67D CCTG_GTCAG-GGCTTGCCAT 175K G 51/- T 45/-
Dm3500 67D ATGCTAGAGT-CGAGACCTTA 143R A 45/33 G 40/39
67D ATGAGGACAT-GAACAGGAAA 185Y C 44/- T 56/-
Dm0417 67E CCAAAAAAAA-TATGACAGAT 194InDel A 31/-
Dm3873 67F AAGACAAAAG------A_ATATA_TA 130InDel ATATAT 42/15
67F AAG______A-ATATA_TATA 137Y C 35/42 T 22/44
67F ___A_ATATA-TATATATATA 143InDel C 42/15
67F ATGTACCCAG-CACATAAGAG 247M A 56/- C 51/-
67F GAACAGTTGC-GACCCGGCTT 267R A 40/- G 40/-
Dm0973 68A CCGCCTACTT-TGCGTCGTGT 216Y T 40/- C 40/-
Dm2335 68A GGAGCCGGAA-TCAAGCGATC 185S C 40/- G 56/-
Dm3724 69D GTCGTCGGCT-GGACGAAGGT 158Y T 29/40 C 39/42
69D GTGCGTTTGG-GCTACCGACG 236R G 33/- A 38/-
Dm3681 70A ATAAGTTGGC-GGCAGAGGA_ 208W T 40/- A 45/-
70A _GGCAGAGGA-GTGATGGATT 218W T 56/- A 56/-
Dm0129 70C GAGTGATGCA-GCCTCCTTGT 160S C 40/35 G 51/40
70C CCGGACAAAA-CAGCCTTCGT 196R A 51/27 G 56/35
Dm1667 70C GCTGGTAAAA-AATCAATATG 77R G -/56 A -/56
70C AGAGGCAATC-TCATAGAACT 283M C 51/32 A 51/30
Dm2052 70C TAACCGAAAA-GCGAGATTAA 170W A 56/11 A 56/56
70C AGAGCAAGCA--GAAAATGGAGA 258KK TT 51/- GG 56/-
70C AAGTGACCGA-AGATACATAG 279R G 45/- A 51/-
Dm2920 70C AGCATTTGAC-TATTAATTCC 37W A 21/51 T 8/40
Dm3580 70C ATCTTAATCT-ATCATAACTA 61Y C 20/42 T -/46
70C GATATCGAAC-TTTC_TGTTC 92Y T 56/56 C 40/44
70C CGAAC_TTTC-TGTT_AGCCT 97K G 40/42 T 40/38
70C TTTTC_TGTT-AGCCT_ATTC 102Y C 16/42 T 10/51
70C TGTT_AGCCT-ATTCCCAAGA 108Y T 42/44 C 40/44
70C AATTGGCGCC-GAACATGGCC 180Y T 45/- C 37/-
Dm1775 70D TAAATTTAAT----TTATAAC_CT_ 1408InDel ACAT 30/-
70D ___TTATAAC-CT_AAACTAT 1419M C 40/46 A 37/24
70D TTATAAC_CT-AAACTATAAA 1422Y C 44/17 T 40/10
70D AGTACACAAC-CCTATACGTT 1465R A 44/- G 40/-
Dm1641 71A TATTGACCAG-GTCCAGATTC 169Y T 35/- C 37/-
Dm3025 71A TGTTGTTCGA-GAGTTATCTG 43K G 18/46 T 25/39
71A TAATTGAAGG-CCGCCGGTTC 103Y T 56/25 C 56/40
71A TCACAGAAAG----ATATATATCT 131RWMY AAAT 56/- GTCC 56/-
71A ATATAAGTTA-AAGCATTCAC 158W A 56/- T 51/-
Dm0184 71B ACTTCCCCCC-CCCAGCCTAT 118W T 56/- A 35/40
71B CCCAGCCTAT-TACTCTGTGT 129W T 56/- A 56/4
Dm1800 72D TAATAAACTA-ATAAGCGATA 72W A 31/- T 33/-
72D AACTCTTAAC-----ATTTGT_AA_ 95InDel ATGAA 28/-
72D ____ATTTGT-AA__CATTAC 106K T 45/- G 40/-
72D _ATTTGT_AA--CATTACAAT_ 109WY AT 56/- TC 40/-
72D __CATTACAAT-TGGAAAGATA 120K G 56/- T (98)/-
72D AAAGATATTT-G_GT____AG 134R A 45/- G 40/-
72D AGATATTT_G-GT____AGTA 136M A 45/- G 40/-
72D TATTT_G_GT----AGTACTTTTA 139InDel TGGG 40/-
72D ATATGTACTT-ACGTATCTAT 175S C 42/- G 45/-
Dm0547 73B GTGAGAGCAA-GTTAGGGCGA 883W A 33/42 T 40/24
Dm2039 74A ATATGGTGTA-GATCGTCACA 266S C 37/- G 45/-
Dm2140 74A GAACAATTTA-TGAATAGGGA 64M C 36/22 A 51/18
74A ACAAAAAGGT-AACTATTTCA 174R G 46/- A 42/-
Dm0632 74B TCGGTTCTCC-TACCTTCCCG 90Y T -/27 C -/40
74B CATTCCCATT-CCATCTCCTC 136Y T 29/19 C 39/56
74B TACAGTGGAT-CCGGTTAACG 294R A 45/- G 45/-
Dm1836 75A TCTTTAGGTC-TGTTTCCGGT 194Y C 40/29 T 46/26
Dm1837 75A TGGGAACCAA-GCCCTCAGCG 96Y C -/35 T -/33
75A TCTTCATCTG-CGTGTCCGCT 123Y T -/35 C -/26
75A AGATCCTTGT-CGCGAACGCC 240M C 40/- A 40/-
Dm3626 75A TGGCGATGGG-GGTGGTTTAA 217W T 51/- A 22/-
Dm0984 75F AGCGGCGGAG-CCGCTATTAA 166Y C 56/46 T 51/10
Dm0970 76B TAGGCATTTG-ATAAAATGCT 974M C 51/- A 51/-
Dm2817 76C ATTCCGTGCG-TGCTGTGGAC 102Y C 32/35 T 40/40
Dm4009 77A TTGCTCATTA-CGATGCTTGC 32Y T 17/- C 23/-
77A TTGTTTACAT-GTGTCCAGTA 166M C 25/- A 30/-
77A GTCCAGTAGT----GGTTATGTTT 179InDel TG** 30/- AGTA 42/-
Dm0980 77E ATTGTCTAAA-CGATATGCTA 124S G 48/37 C 42/44
Dm3082 78E GTAGCAAGCC-GATCTGGACC 219S G 40/- C 30/-
Dm2753 79E AATTAACCCT-TCGCAGTCTT 44InDel C -/38
79E CAGAAAGTAT-CAACTGCAAC 113R A 56/31 G 40/33
Dm2182 83C ATGCCATTGG-AAACAGTCGG 67W A 40/7 T 32/21
83C CAGGTGAGTT-CACTGCCTTC 115Y T 44/21 C 11/30
Dm0077 84A AGTTCAAAAA-TTTGAAAACT 58K G 48/- T 56/-
Dm1875 84A CTGGGATTCT-CGGATGACTG 22Y T 51/- C 40/-
84A GTTTTTTTTT-GCTAGTCGCC 156InDel T 25/-
Dm3390 84D AGGAGTGGCC-TGCATCTCGC 75R G 37/40 A 35/44
84D CGGCGTCGCG-CACGTACCAT 175InDel G 40/-
84D ATAGGCATCT-GAGCAGGGAC 194R A 51/- G 56/-
Dm3347 84E CCGAGGGATA-CGGCCGTTTG 191K T 40/- G 45/15
Dm1000 84F ATCAAGTGTC-AATAGTATGG 108M A 56/40 T 30/51
84F TTACGCAAGT-TTGCCGATCA 152Y C 56/35 T 56/10
84F ACTAGGTTGT-ATAGAATTTA 213W A 45/- T 56/-
Dm2752 85A TGTGCTCGCT-AAGATGGAAA 152K G 40/40 T 45/42
Dm1582 85B ACTTGTATCG-CTTGCTATGT 192Y C 37/- T 45/-
Dm1568 86A ACAAGAACTC-TCCACATTGA 141M A 46/40 C 56/56
Dm1569 86A TCGGATTGTT-CACATTTTGT 225R G 46/- A 51/-
Dm1922 86C CGAGGGGTGG-GTTCCATCTT 1096Y C 35/56 T 45/43
Dm2758 86C CGTTGTGTGC-TGGTCTTT_A 186R G 37/35 A 51/19
86C C_TGGTCTTT-ACAGGCTTAA 195Y T 48/33 C 56/7
86C TAGGCTGCAC-CGTCGCTGTG 237R A 27/- G 40/-
Dm2915 86C CCCGGCCGAT-AAGCTGACAG 193InDel T 51/-
Dm3564 86C TGGGAAATGT-TGAGAATGAA 147R A 51/19 G 51/29
Dm3727 86C ACGCTAGTTT-GTTTGTTTTA 64Y C 9/56 T 9/51
86C ATTCTGATTC-T_AAATTAAT 109K T 42/51 G 51/40
86C TCTGATTC_T-AAATTAATCC 111W A 42/51 T 51/45
Dm3322 86D CAACGAATAA-TTCATAATCA 32S G 51/- C 34/-
86D AAAAATGACA-TTGATAGTGG 57W A -/42 T -/42
86D TGAACGAGGG-GACGGAGAGT 192R A 40/36 G 40/40
Dm3328 86D CTTTTTCGTT-GCCTTGATTT 42Y C 18/- T 27/-
Dm1774 87C ATCAAAGCGT-ACTG_TTTAA 68W A 40/- T 44/42
87C AGCGT_ACTG-TTTAATCATC 73R G 45/- A 56/42
87C CGCATGATAA-AGTGCTAATT 93W A 51/- T 56/38
87C ATATAAAAGA-ATT_TTTTTT 140Y C 46/- T 56/27
87C AAAAGA_ATT-TTTTTTATTT 144M A 45/- C 56/8
87C AGGCTGGGAG-CGC_GCTGA_ 202R G 40/- A 45/-
87C TGGGAG_CGC-GCTGA_GGGG 206K T 40/- G 40/-
87C _CGC_GCTGA-GGGGAGTAGG 212S G 51/- C 40/-
Dm3326 87F AGTCAGCTGG-AAATAGGAAA 870InDel ACATGAACTTATTCAGCAACG -/35
Dm3401 87F GAGCCAAGTG-TTGGGTGCTG 172Y C 51/10 T 51/32
Dm0038 88B GTATGTTTCT-TTTTTATATT 152W A 40/37 T 56/56
Dm1791 88D CCAAACAGTC-CCC_CCCCC_ 103InDel C 48/-
Dm2956 89A TTCAGAGTGT-AT_ATACAAT 183R G 51/- A 51/-
89A AGAGTGT_AT-ATACAATTTC 186R A 56/- G 56/-
Dm1521 89B GCTTCGATGT-GGCGCCATGA 33M C -/40 A -/40
89B TTCTCGCGGC-TCGATTAACT 90M A 56/51 C 40/45
Dm2709 89D ATGAGCTGCT-TA_TCCATGA 50S C 19/33 G 46/21
89D AGCTGCT_TA-TCCATGAT_C 53Y C 37/42 T 39/9
89D A_TCCATGAT-CCGCG_CCCA 62W T 56/46 A 37/(16)
89D TGAT_CCGCG-CCCATTGCCG 68R G 35/35 A 37/(27)
89D CCATTGCCGA--GAATG_GA_G 80RM AA 51/44 GC 42/25
89D CGA__GAATG-GA___AGCGA 87M C 40/37 A 41/11
89D __GAATG_GA---AGCGA_GA_CA 90M CTC 35/38 AAG 56/13
89D GA___AGCGA-GA_CA_GT_T 98R A 11/48 G 32/9
89D __AGCGA_GA-CA_GT_TG_C 101R A 29/37 G 44/8
89D GCGA_GA_CA-GT_TG_CAGA 104S G 45/36 C 45/8
89D A_GA_CA_GT-TG_CAGAGTT 107K T 51/40 G 45/29
89D A_CA_GT_TG-CAGAGTTTCG 110Y C 45/33 T 45/15
Dm1654 89E GGAAGTCGCG-CACATTTTGC 245W T 39/13 A 35/32
89E TCGCTATCTG-TGAAGTTGGA 285Y T 45/- C 51/-
Dm1763 90A GAGGCCTCGT-GACAAAGGGA 166Y T 46/37 C 27/37
90A CCGTACTTTT-CGCTTTCCAC 242Y C 42/42 T 37/40
Dm2494 90A ATCTATCGGG-TACTAATGGA 847M A 51/42 C 37/40
90A ATCTAATGCT-AGCTACAATA 902W A 51/29 T 51/19
Dm2629 91C CGTTTGCACC-TCACCCTGGC 107Y C 39/21 T 46/42
Dm0282 91F TTGAAAATAT-TACAATTAAT 114M C 43/46 A 56/48
91F TAAAGGTTGT--TAATTTTGCC 136Y TC 40/40 CT 56/37
Dm1709 91F TTATTTTCGC-GACTTAGGAG 287M C 40/- A 45/-
91F ACTTAGGAGC-CTTCCCTCGC 299S C 56/- G 35/-
Dm0323 92B TCTCTTCCTG-TATATTATAA 80InDel GCGAA 40/31
Dm1680 92B ACTATAATAA-TC_AATAAGA 122Y C 45/- A 46/-
92B ATAATAA_TC-AATAAGAA_A 125K T 40/- G 42/-
92B C_AATAAGAA-AGGCACTTAA 134R A 56/- G 56/-
92B ATATGCCACT-TAAGACC___ 198W T 40/- A 45/-
92B CT_TAAGACC----CCTAA_TT_G 206InDel ATCC 42/-
92B C____CCTAA-TT_GAT_GTA 215W T 56/- A 56/-
92B __CCTAA_TT-GAT_GTAATA 218K T 51/- G 56/-
92B TAA_TT_GAT-GTAATATAGT 222Y T 40/- C 45/-
Dm2387 92B GCAAAAAGAA-CCCGGCTAGG 139S G 56/- C 51/40
Dm3710 92B GTTTACATAT-TATATGTATG 182K T 56/- G 27/-
92B ATGTACCCAG-CACATAAGAG 230M A 56/- C 51/-
92B GAACAGTTGC-GACCCGGCTT 250R A 40/- G 35/-
Dm3293 92D GTCCATTGTG-GACCCTTTGC 133Y C 40/37 T 40/51
92D TGAGGACTGA-CTGCACAAAG 151S C 44/42 G 37/56
92D TCCTTGGAAT-AGAATCTTTC 222Y C 40/- T 45/-
Dm2937 93F GTATATATAT--TTAAAATGCA 162InDel AT 40/-
Dm2730 94C CTGGCAAAAA-TCATTGTAGG 104Y C 27/37 T 32/9
Dm0869 94D ACATTTTATT----AATGC_TA__ 115InDel GCTT 40/- TGGA 56/-
94D T____AATGC-TA________ 124Y T 38/- C 56/-
94D __AATGC_TA---AG_____ATAG 127InDel GAT 45/-
94D GC_TA___AG-----ATAGTTATTG 130InDel TTTTC 51/-
94D GCAGTGCATA-ATTT_T____ 156W A 56/- T 56/-
94D GCATA_ATTT-T____TA___ 161InDel A 51/-
94D ATA_ATTT_T----TA______CT 163InDel GCAG 51/-
94D TT_T____TA------CTTTTTTTT_ 169InDel GGTATA 51/-
94D _CTTTTTTTT-GATAAAACTA 183InDel T 42/-
94D AAGACAAATG-CAGTTTCCA_ 245Y C 37/- T 42/-
94D _CAGTTTCCA-GTTAATAATG 255W A 51/- T 56/-
Dm1602 94D CCAGCTCTAG-AATTGCTCCA 71Y C 40/- T 40/-
94D ACGACGAAAA-TTGGAACGCT 152R A 56/- G 48/-
94D TGGATCGAAA-TTGGTGTCGA 176R G 56/- A 56/-
Dm1690 95A TGAACTCTTT-GCCTG_TTAT 194Y C 40/40 T 56/47
95A CTTT_GCCTG-TTATTGTTCT 200W A 56/45 T 56/46
95A ATTAAAGTGA-ATTGTATTCT 225Y T 56/46 C 56/33
95A TAGTATATAT-TAAACGATAT 276M A 51/24 C 51/-
Dm1710 95B GCAAAGCCGT-TGTGTGGAAG 145Y T 40/56 C 40/37
95B GCTTAGACTA-AAATTTGCAG 273R G 40/- A 45/-
95B TTAAAATAAA-CATGGAAATG 319Y T 42/- C 45/-
Dm3365 95B AAACTATACT-TCGAATAAAG 118R G 51/42 A 51/42
95B TATTAATGAA-GTGATAACGA 159Y T 51/26 C 45/27
95B TTCATCCCCC-TATCATTTTC 199InDel C 56/-
Dm3749 95C AGTTGTATCT-TTATCATTTG 99W A 45/40 T 56/56
95C CCTGCCCTAT-GTGGACGCCA 146Y T 45/43 C 45/40
Dm1592 95D TGTCCAGACA-TTCACTTGCT 46Y T 16/44 C 6/56
Dm0337 95E TCTCTTCCTG-TATATTATAA 487S G 56/- C 51/10
Dm2238 96A GTTACGCCAC-TTTGAGAAGG 185S C 42/42 G 37/16
Dm1624 96B GCGGAGAAGG-GTATCCGTGA 317W T 40/- A 40/38
96B GTATCCGTGA-AAAGAAAGAG 328W T 38/- A 42/56
96B TCCAGTTCGT-CC_CA_ATGA 446S C 42/- G 40/-
96B AGTTCGT_CC-CA_ATGACCG 449S C 44/- G 35/-
96B TCGT_CC_CA-ATGACCGCCT 452Y C 56/- T 40/-
Dm1683 96C TATTTTATTG-TTATATATAT 918Y C 51/56 T 37/56
Dm2258 96C TTTTGTTTGA-TTATTATTGT 187R G 51/- A 45/-
Dm1592 96D TGTCCAGACA-TTCACTTGCT 46Y T -/44 C -/56
Dm0667 96E CATTTCTAGC-TTGAATGCCA 76Y T 56/- C 51/33
96E AGTCCGGCGA---TTTAGATTAT 119InDel GGTATGGCATTCTATG 56/-
96E ATAAAAAACT-ATT_TTTTTA 172K G 56/- T 56/-
96E AAAACT_ATT-TTTTTAAGCA 176R A 51/- G 37/-
96E TTAAGCAGAA-ATTGAGATTT 190W T 56/- A 56/-
96E GAGATTTGGC-AAAAT_C_TA 204M A 51/- C 42/-
96E TGGC_AAAAT-C_TATTTTAC 210R G 56/- A 38/-
96E GC_AAAAT_C-TATTTTACGG 212R A 56/- G 40/-
Dm1582 96F CCTGAAATAG-GTTAGTTACT 140W T 51/- A 40/-
Dm1705 96F TTGTGTGCGG-AGATCCTTTT 231K G 51/- T 45/-
Dm4157 96F GGCGTGACCC-TTTTGGCTTA 314W T 51/- A 40/-
Dm1644 97B TCTGTGGGGG-G_AAGAGCAT 75Y T 31/51 C 35/45
97B TGTGGGGG_G-AAGAGCATTA 77R G 46/56 A 29/51
97B ACTCGTATAA-AGATAGCACG 143M A 51/51 C 46/40
97B ATAGCACGAT-ACTAATTAGC 156Y T 40/51 C 51/42
97B TTGAGTACAA-GACATTAACG 242R A 56/- G 51/-
Dm3858 97B GTTTACATAT-TATATGTATG 199K G 51/34 T 56/35
Dm1657 97C AAATCAGTTT-TGTTTATGTT 87K T 40/56 G 40/56
97C TTTCCGCCCC-CCATCCTGCT 112R A 40/51 G 40/31
Dm3633 97D GGCGCCATTG-CACAAGATCT 185Y T 56/16 C 37/8
97D CTGGTTGGCT-GCCAGCTAGC 278R G 40/- A 34/-
Dm3772 97F GTACTTCTTT-ATGCATGTTT 145R G 42/35 A 42/51
Dm2412 98C TTGCGGGAAA-GTTCTGTATT 191W A 56/48 T 42/-
98C TAGTCCCGCT-CATGGCTGGT 212Y T 38/- C 37/-
Dm3397 98D TTGTGCCCTT-CGTTCATTTT 49Y C -/33 T -/40
98D AAATGGTCAG-CGGCAGGCGG 72Y T 24/37 C 26/40
98D GTATCTGCGC-ATGTTTTTCT 206M A 40/34 C 46/-
Dm3592 98E TCCCCCCCGT-CTCAAGTGGC 233K G 40/- T 42/-
Dm2361 98F ACACATAGGC-AAAACGATCT 206Y C 45/9 T 45/42
98F AATAGATTTA-GGCAAGGTGC 261R A 56/- G 45/-
98F CAAGGTGCAG-TCTTTTGGCT 274R G 56/- A 51/-
Dm2892 98F TGAGCGTCTT-TTCTCGTAAT 47R G 21/25 A 28/42
98F AAAGTGTTTG--TTTTTTTTAT 88InDel TT 45/42
98F TTTTTTTTAT-TTAATCGCTG 100W T 42/42 A 40/42
Dm2822 99B AGAAGACCAG-TAGCC_AGGT 1169R A -/34 G -/35
99B CCAG_TAGCC-AGGTGCTC_G 1175Y T -/42 C -/42
99B C_AGGTGCTC-GTGAAGGTGC 1184R A -/31 G -/42
99B CATCCCTCGC-GCTCGCCACC 1226M A 45/42 C 40/36
99B CGGCTATCAG-CCGGCCGCTC 1292W T 43/30 A 37/10
99B TGGGATAGCT-AAGGGATCCG 1331R G 45/- 40/-
Dm2926 99B TAAAGAAATA-GAATTACACA 64Y T 46/- C 40/-
99B GGGTATGTGT-GGCCTCTCAA 150K T 45/- G 51/-
99B GTATGTGTTG-CCTCTCAAGC 152S G 40/- C 42/-
Dm2473 99D GCCAGGTCGC-GAATCAATGC 153Y T 40/- C nophred/-
99D CGAATTGGCT-CA_CCGGAGC 173Y T 40/- C nophred/-
99D ATTGGCT_CA-CCGGAGCCGT 176R A 40/- G 22/-
Dm2388 100A CTCACTGCAC-ATTAAGTGGG 103Y C 35/37 T 51/35
Dm2530 100A GTGTTAATAA-AAAAAAAAAA 82InDel A 33/-
Dm2288 100B ACTCGCTGCT-CATTTCTTCA 85Y T 37/44 C 40/42
100B AATTTTGGC-------GTTCCGCGAC 156InDel GTTTGGT 40/29
100B GCGGACAAAG-TGCGTCTTTG 184Y C 37/29 T 51/12
Dm3454 100B GACACGCGAA-TTTGCTCCCC 175M C 37/12 A 42/4
100B GACACGCGAA-TTTGCTCCCC 188M A 47/- C 30/4
Dm2249 100C TGACGAACAC-TCAAAGGCAG 24M C -/42 A -/42
100C GAGGGAAGAC-AACCGCATCT 88R A 40/37 G 37/40
Dm2521 100C CTGTCCTTGC-AGAAGATTAA 150K G 40/- T 17/(13)
100C CTTCGTACCT---GGAAACTAAG 199InDel TT* 44/- GGG 37/-
Dm3116 100C TTTTATTTTT-CTGCTTTATG 150R G 45/- A 45/-