BDGP Resources

Donor Vectors

We use the pDNR-Dual vector and Clontech's In-Fusion PCR Cloning System to generate the ExpressR-NS and ExpressR-O clones. The important features of pDNR-Dual are the placement of multiple-cloning sites (MCS), a splice donor sequence, a 6xHN tag, and a selectable marker (a promotor-less chloramphenicol resistance gene) between two flanking loxP sites. The features between the loxP sites are transferred to an appropriate acceptor vector via site-specific recombination using Cre recombinase.


Expression Vectors

Four widely used Drosophila expression vectors1 were converted, via insertion of a single loxP site, to accept ORFs from the ExpressR-NS and ExpressR-O clones to generate both 5' and 3' fusions. These vectors are used for inducible protein expression in tissue culture cells under the metallothionein-inducible promoter (pMK33-based vectors) and in transgenic flies under GAL4-inducible UAS promoter (pUAST-based vectors). The vectors each contain an epitope tag positioned to create N-terminal or C-terminal fusion proteins. The TAP and Flag-HA tags provide an efficient and reliable way to recover protein complexes present at low cellular expression levels under native conditions. A description of the parent vectors from which these originate can be found here.

Engineered Expression Vectors

Vector name System Promoter N-term Tag C-term Tag Selectable Marker Comments
E. coli Drosophila
pMK33-NTAP-BD Cell Culture Metallothionein TAP ----- Ampicillin Hygromycin B Dual-affinity cleavable Tag
pMK33-CTAP-BD Cell Culture Metallothionein ----- TAP Ampicillin Hygromycin B Dual-affinity cleavable Tag
pMK33-NFHis-BD Cell Culture Metallothionein Flag-6xHis ----- Ampicillin Hygromycin B
pMK33-CSG-BD Cell Culture Metallothionein ----- Streptavidin-proteinGb Ampicillin Hygromycin B Dual-affinity cleavable Tag
pMK33-CK-BD Cell Culture Metallothionein ----- Flag-StrepII-Hisc Ampicillin Hygromycin B Dual-affinity cleavable Tag
pMK33-NFH-BD Cell Culture Metallothionein Flag-HA ----- Ampicillin Hygromycin B
pMK33-CFH-BD Cell Culture Metallothionein ----- Flag-HA Ampicillin Hygromycin B
pMK33-CHF-BD Cell Culture Metallothionein ----- HA-Flag Ampicillin Hygromycin B
pUAST-NTAP-BD Gal4-UAS UAS TAP ----- Ampicillin white Dual-affinity cleavable Tag. P-element transformation
pUAST-CTAP-BD Gal4-UAS UAS ----- TAP Ampicillin white Dual-affinity cleavable Tag. P-element transformation
pUAST-CTAP-BDattB Gal4-UAS UAS ----- TAP Ampicillin white Dual-affinity cleavable Tag. PhiC31 transformation
pDest17-BD E.coli T7 6xHis ----- Ampicillin -----
pET44a-BD E.coli T7 6xHis-NusA ----- Ampicillin -----
pUAST-CFH-BDattB Gal4-UAS UAS ----- Flag-HA Ampicillin white PhiC31 transformation
pUAS-C-EGFP-BD-attB Gal4-UAS UAS ----- eGFP Ampicillin white PhiC31 transformation
pUAS-C-mCherry-BD-attB Gal4-UAS UAS ----- mCherry Ampicillin white PhiC31 transformation
pUAS-N-EGFP-BD-attB Gal4-UAS UAS ----- eGFP Ampicillin white PhiC31 transformation
pUAS-N-mCherry-BD-attB Gal4-UAS UAS ----- mCherry Ampicillin white PhiC31 transformation

Donor Vectors

Vector name System Promoter N-term Tag C-term Tag Selectable Marker Comments
E. coli Drosophila
pDNR-Dual E.coli T7 ----- 6xHN Ampicillin** -----

**Note: The pDNR-Dual vector also contains a Chloramphenicol resistance gene whose expression is driven by a bacterial promoter in the pMK33 or pUAST acceptor vectors, above. There is also a sucrase gene (SacB) in pDNR-Dual, which provides negative selection against incorrect recombinants and the parental donor vector following Cre-loxP recombination.

Vector Sequences


>pMK33-NTAP-BD, 8930 bases.
CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA
GGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCATTGGACCGCTGATCGTCACGGCG
ATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTA
TACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGA
ATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAAT
TCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCG
CCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGC
GCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTT
AGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTG
CGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGC
GGAAGTCAGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGAT
AACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCC
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGA
AGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTT
CTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTG
TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGC
GCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTG
GCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTC
TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTG
CTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACC
GCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCT
CAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGT
TAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAA
AAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAA
TGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCC
TGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCT
GCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCA
GCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT
AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTT
GCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCC
GGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC
TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTT
ATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACT
GGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGC
CCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATT
GGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCG
ATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCT
GGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAA
TGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGT
CTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGC
ACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACC
TATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCACATTTGTACGAATT
TTTTTTTTATCAAAAGTTCGAGTTTTTCACCAATTTCCTCATCAACCGAGCAAGGCAAAC
GGCTTTGAATAATATGGTGTTATATATACATATATCAAATCGCTGCTGACTGCGTGATTG
ATGGCCCCAAGATTACATATTATCGAATCAGGATTCAGAAGGAGATCAATGTCAAATGCG
GACAGGAACATGAAAGACGCCTGTTATGCGCAATTAAAAATTTGGGTTTAATTGCTGTGG
AAACTGTTGTTGGCGGCATCTTAAGTTCCTGTTTAACAACATCAACTACTTATGTACGTA
GAAGCGTTTAAGCCATTTGCATACAGATGAGAACTGGCTTTTGTGCTAATCAGTCAAGAT
GACTCCGATGATGATGACTCATTACCTGACCAGTTTTCGCTGCTTTCTTTTCAACAACTA
CTTGTATATGTATTGTATCCAATAGCAATACATTGAATTTCCATGGTCTAGTCACGTATT
ATCATTTAATTGACACCAAGTCGTGTTATTGTTGAGCTATCGAGTTCAGCTCAAACATTT
CTTATTCCCATGAATAAGCCGGCAAAAATATGCAATCTATGAAAGTTAATATAAGCAAAC
CTTACTTTGACTCAATACCAATGCACTTTGTGTCGATAGGTTCACGCAATTGAGGCGATT
ATTCCGATAACCCAAGCGATTGACTGTTCCCGTTTCGATTCCAATTGAAATTTGGAAATG
TACAATAGTTTTGCTATATGCTGTCAAGTACGCTCTTATCTTCTCTGGGTTTTCTTCAGA
GTTTCGAAACGCTTCTTCTTTTTTTTGTTTTTTTTTTTTTGGAATCTCGTATTTTGGAAG
GGGCTCCCCTCTGGAATTTGTTACACTGTCGTTATCATTGCGAACAAGCGGCCCGAAGCT
ATCAGCGACTTTAACATTTACAATGCACTTTTTTACGACCAATTAAATGTACATTTTCCT
TTCTTCGCCCGTTGATAAGCGAACGCGATGTGGCGCAGGCAATGTGTTGCTCTTGCGACA
CAAACGCAATCAAAATGGATTCAATTTCGCTTTTTCCCAGTGAAACGAAGAACGAACCGA
CCATCATGATATGCTCCTCTGCATGTTGCGTATTGAATCAATGACAATTTCAATTAAGCC
GCCCGTTCGTCATGCGTTTTCGTGCGCTTCGAAATGCTGATAACGCTGCTGTCCTCCAAC
TGCTTTGCATGTGGACACAATTCCATTTATTTAATTCTTTTATTTGGATCGGTTAAATTA
AAAAGCGCCTTGTTACGCATTTAACGTTGTTTCCGGTGCGTGGTGGTTTCATGCTTCTGG
GAACGGCAAATGGGTTTAGGATTGGGAACCCCTCATCATCTGTTGGAATATACTATTCAA
CCTACAAAAGTAACGTTAAACAACACTACTTTATATTTGATATGAATGGCCACACCTTTT
ATGCCATAAAACATATTGTAAGAGAATACCACTCTTTTTATTCCTTCTTTCCTTCTTGTA
CGTTTTTTGCTGTAAGTAGGTCGTGGTGCTGGTGTTGCAGTTGAAATAACTTAAAATATA
AATCATAAAACTCAAACATAAACTTGACTATTTATTTATTTATTAAGAAAGGAAATATAA
ATTATAAATTACAACAGGTTATGGACCTGCAGCCAAGCTTGGCGCTCGTCCGGGGGCAAT
GAGATATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGT
TCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCT
TCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACA
AAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTG
ACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCA
CGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCA
TGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGC
AAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATG
TGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCG
ATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATT
TCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCG
AGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGT
TGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGAT
CGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGG
TTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGAT
CCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCG
ATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGG
CAAAGGAATAGAGTAGATGCCGACCGAACAAGAGCTGATTTCGAGAACGCCTCAGCCAGC
AACTCGCGCGAGCCTAGCAAGGCAAATGCGAGAGAACGGCCTTACGCTTGGTGGCACAGT
TCTCGTCCACAGTTCGCTAAGCTCGCTCGGCTGGGTCGCGGGAGGGCCGGTCGCAGTGAT
TCAGGCCCTTCTGGATTGTGTTGGTCCCCAGGGCACGATTGTCATGCCCACGCACTCGGG
TGATCTGACTGATCCCGCAGATTGGAGATCGCCGCCCGTGCCTGCCGATTGGGTGCAGAT
CTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGAT
TTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCT
AATTGTTTGTGTATTTTAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGTGGAA
TGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGATGATGAGGC
TACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAA
GGACTTTCCTTCAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAACTCT
TGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGCACTGCTATACAAGAAAATTAT
GGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAACATACTGTT
TTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTCAAAAATTGTG
TACCTTTAGCTTTTTAATTTGTAAAGGGGTTAATAAGGAATATTTGATGTATAGTGCCTT
GACTAGAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACC
TCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGT
TTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAG
CATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATG
TCTGGATCAATTCGTTGCAGGACAGGATGTGGTGCCCGATGTGACTAGCTCTTTGCTGCA
GGCCGTCCTATCCTCTGGTTCCGATAAGAGACCCAGAACTCCGGCCCCCCACCGCCCACC
GCCACCCCCATACATATGTGGTACGCAAGTAAGAGTGCCTGCGCATGCCCCATGTGCCCC
ACCAAGAGCTTTGCATCCCATACAAGTCCCCAAAGTGGAGAACCGAACCAATTCTTCGCG
GGCAGAACAAAAGCTTCTGCACACGTCTCCACTCGAATTTGGAGCCGGCCGGCGTGTGCA
AAAGAGGTGAATCGAACGAAAGACCCGTGTGTAAAGCCGCGTTTCCAAAATGTATAAAAC
CGAGAGCATCTGGCCAATGTGCATCAGTTGTGGTCAGCAGCAAAATCAAGTGAATCATCT
CAGTGCAACTAAAGGGGGGATCTCGACACCATGGCAGGCCTTGCGCAACACGATGAAGCC
GTGGACAACAAATTCAACAAAGAACAACAAAACGCGTTCTATGAGATCTTACATTTACCT
AACTTAAACGAAGAACAACGAAACGCCTTCATCCAAAGTTTAAAAGATGACCCAAGCCAA
AGCGCTAACCTTTTAGCAGAAGCTAAAAAGCTAAATGATGCTCAGGCGCCGAAAGTAGAC
AACAAATTCAACAAAGAACAACAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTA
AACGAAGAACAACGAAACGCCTTCATCCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCT
AACCTTTTAGCAGAAGCTAAAAAGCTAAATGATGCTCAGGCGCCGAAAGTAGACGCGAAT
TGTGATATACCTACAACTGCTTCTGAAAATTTATATTTTCAAGGTGAACTAAAGAGAAGA
TGGAAAAAGAATTTCATAGCCGTCTCAGCAGCCAACCGCTTTAAGAAAATCTCATCCTCC
GGGGCACTTGATGATGACGATAAGCTCGAGGGATCCATAACTTCGTATAGCATACATTAT
ACGAAGTTATAGATCCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGA
TACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGA
AAAGTGCCACCTGACGTACTAGTTCTAGTCGACCATGAAGATCAAGATCATTGCCCCGCC
AGAGCGCAAGTACTCTGTCTGGATCGGTGGCTCCATCCTGGCTTCGCTGTCCACCTTCCA
GCAGATGTGGATCTCCAAGCAGGAGTACGACGAGTCCGGCCCCTCCATTGTGCACCGCAA
GTGCTTCTAAGAAGGATCGCTTGTCTGGGCAAGAGGATCAGGATCGGGATGGTCTTGATT
CTGCTGGAGGAGGAGGAGGAGAAGTCGAGGAAGCAGCAGCGAAAGTGCAAGTGCGAGTGG
TGGAAGTTTGGAGTGCAGCACAACAAAATCAACAACAACACCAACTACAAGATGAAAAGA
GCGGAACCACCTGCACACCATCATCACTATCATCATCGTTTTGGGCGCATGTTGTGTGGT
TCCAGCGTATTAATATAATTAATTTATTCCACATGAGATATGATATGATATACTATGTAT
TTTTTGTTTTTTTTTTATTTGTAAACCTTTAATATAACAAGAACTACAAAAAATGAAAAT
GAGCGAAAATGCATATTCTGCCATTCCACACACACACCAACAACACCCAACACACGCACA
CCCACAAGCTTACACACACACATTCGCGGCATGACAAGGACATCAAGATAAAGAAGAACT
TAAAGAAGATATTTCCCAAAGCGCAAAAAGAACACACACACATTGCAAAACACAAACAAC
ACACTAGCGTTTTGTACAATTCGTCAGCAACCTTATGTATTATTTTTTAATTATGATGTA
ATTATAAACAAAGTGAAACAAAAATATGAAAACAAAAAGGAAAATCAAATCTGTCTTCTC
TTTCTCCCGCTCTCCTCGCTCTCTGCTGCTAACCTCGCCCTCTCCTCTCTCATCTTTTTG
TCTGTCTCTCTTCCACATTTTTGCCGGCCGGCAAAATAATAACCCACACACACTCACACT
TGGCTGCAGTTTCGCGTGCGATATTCACACACATTCAAGCATACAAGCATACATACATAT
GTATTTTTTTTTTATTTGTACACTTTTCTAATTGCATGCGTATCGATTGATAAGTTTACG
CCTGAAAATGTTAATTAAAATGTGAAAATGCAACTGAAAAACTGATGAAATGAAACAACA
ACAAGCGAACAATTTGCTACATGTGTATTGTCTAACAACCGTTACTGCAACGGTTGCTTC
GGAAAAGGGTGAAGAGGAAGAGGGCACGAGGTCGACTAGAGCGGCCGCCGACGCGAGGCT
GGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATG

>pMK33-CTAP-BD, 9036 bases.
CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA
GGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCATTGGACCGCTGATCGTCACGGCG
ATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTA
TACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGA
ATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAAT
TCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCG
CCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGC
GCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTT
AGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTG
CGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGC
GGAAGTCAGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGAT
AACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCC
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGA
AGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTT
CTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTG
TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGC
GCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTG
GCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTC
TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTG
CTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACC
GCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCT
CAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGT
TAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAA
AAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAA
TGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCC
TGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCT
GCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCA
GCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT
AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTT
GCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCC
GGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC
TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTT
ATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACT
GGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGC
CCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATT
GGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCG
ATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCT
GGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAA
TGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGT
CTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGC
ACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACC
TATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCACATTTGTACGAATT
TTTTTTTTATCAAAAGTTCGAGTTTTTCACCAATTTCCTCATCAACCGAGCAAGGCAAAC
GGCTTTGAATAATATGGTGTTATATATACATATATCAAATCGCTGCTGACTGCGTGATTG
ATGGCCCCAAGATTACATATTATCGAATCAGGATTCAGAAGGAGATCAATGTCAAATGCG
GACAGGAACATGAAAGACGCCTGTTATGCGCAATTAAAAATTTGGGTTTAATTGCTGTGG
AAACTGTTGTTGGCGGCATCTTAAGTTCCTGTTTAACAACATCAACTACTTATGTACGTA
GAAGCGTTTAAGCCATTTGCATACAGATGAGAACTGGCTTTTGTGCTAATCAGTCAAGAT
GACTCCGATGATGATGACTCATTACCTGACCAGTTTTCGCTGCTTTCTTTTCAACAACTA
CTTGTATATGTATTGTATCCAATAGCAATACATTGAATTTCCATGGTCTAGTCACGTATT
ATCATTTAATTGACACCAAGTCGTGTTATTGTTGAGCTATCGAGTTCAGCTCAAACATTT
CTTATTCCCATGAATAAGCCGGCAAAAATATGCAATCTATGAAAGTTAATATAAGCAAAC
CTTACTTTGACTCAATACCAATGCACTTTGTGTCGATAGGTTCACGCAATTGAGGCGATT
ATTCCGATAACCCAAGCGATTGACTGTTCCCGTTTCGATTCCAATTGAAATTTGGAAATG
TACAATAGTTTTGCTATATGCTGTCAAGTACGCTCTTATCTTCTCTGGGTTTTCTTCAGA
GTTTCGAAACGCTTCTTCTTTTTTTTGTTTTTTTTTTTTTGGAATCTCGTATTTTGGAAG
GGGCTCCCCTCTGGAATTTGTTACACTGTCGTTATCATTGCGAACAAGCGGCCCGAAGCT
ATCAGCGACTTTAACATTTACAATGCACTTTTTTACGACCAATTAAATGTACATTTTCCT
TTCTTCGCCCGTTGATAAGCGAACGCGATGTGGCGCAGGCAATGTGTTGCTCTTGCGACA
CAAACGCAATCAAAATGGATTCAATTTCGCTTTTTCCCAGTGAAACGAAGAACGAACCGA
CCATCATGATATGCTCCTCTGCATGTTGCGTATTGAATCAATGACAATTTCAATTAAGCC
GCCCGTTCGTCATGCGTTTTCGTGCGCTTCGAAATGCTGATAACGCTGCTGTCCTCCAAC
TGCTTTGCATGTGGACACAATTCCATTTATTTAATTCTTTTATTTGGATCGGTTAAATTA
AAAAGCGCCTTGTTACGCATTTAACGTTGTTTCCGGTGCGTGGTGGTTTCATGCTTCTGG
GAACGGCAAATGGGTTTAGGATTGGGAACCCCTCATCATCTGTTGGAATATACTATTCAA
CCTACAAAAGTAACGTTAAACAACACTACTTTATATTTGATATGAATGGCCACACCTTTT
ATGCCATAAAACATATTGTAAGAGAATACCACTCTTTTTATTCCTTCTTTCCTTCTTGTA
CGTTTTTTGCTGTAAGTAGGTCGTGGTGCTGGTGTTGCAGTTGAAATAACTTAAAATATA
AATCATAAAACTCAAACATAAACTTGACTATTTATTTATTTATTAAGAAAGGAAATATAA
ATTATAAATTACAACAGGTTATGGACCTGCAGCCAAGCTTGGCGCTCGTCCGGGGGCAAT
GAGATATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGT
TCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCT
TCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACA
AAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTG
ACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCA
CGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCA
TGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGC
AAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATG
TGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCG
ATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATT
TCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCG
AGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGT
TGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGAT
CGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGG
TTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGAT
CCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCG
ATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGG
CAAAGGAATAGAGTAGATGCCGACCGAACAAGAGCTGATTTCGAGAACGCCTCAGCCAGC
AACTCGCGCGAGCCTAGCAAGGCAAATGCGAGAGAACGGCCTTACGCTTGGTGGCACAGT
TCTCGTCCACAGTTCGCTAAGCTCGCTCGGCTGGGTCGCGGGAGGGCCGGTCGCAGTGAT
TCAGGCCCTTCTGGATTGTGTTGGTCCCCAGGGCACGATTGTCATGCCCACGCACTCGGG
TGATCTGACTGATCCCGCAGATTGGAGATCGCCGCCCGTGCCTGCCGATTGGGTGCAGAT
CTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGAT
TTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCT
AATTGTTTGTGTATTTTAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGTGGAA
TGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGATGATGAGGC
TACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAA
GGACTTTCCTTCAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAACTCT
TGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGCACTGCTATACAAGAAAATTAT
GGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAACATACTGTT
TTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTCAAAAATTGTG
TACCTTTAGCTTTTTAATTTGTAAAGGGGTTAATAAGGAATATTTGATGTATAGTGCCTT
GACTAGAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACC
TCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGT
TTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAG
CATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATG
TCTGGATCAATTCGTTGCAGGACAGGATGTGGTGCCCGATGTGACTAGCTCTTTGCTGCA
GGCCGTCCTATCCTCTGGTTCCGATAAGAGACCCAGAACTCCGGCCCCCCACCGCCCACC
GCCACCCCCATACATATGTGGTACGCAAGTAAGAGTGCCTGCGCATGCCCCATGTGCCCC
ACCAAGAGCTTTGCATCCCATACAAGTCCCCAAAGTGGAGAACCGAACCAATTCTTCGCG
GGCAGAACAAAAGCTTCTGCACACGTCTCCACTCGAATTTGGAGCCGGCCGGCGTGTGCA
AAAGAGGTGAATCGAACGAAAGACCCGTGTGTAAAGCCGCGTTTCCAAAATGTATAAAAC
CGAGAGCATCTGGCCAATGTGCATCAGTTGTGGTCAGCAGCAAAATCAAGTGAATCATCT
CAGTGCAACTAAAGGGGGGATCTCGAGGGATCCATAACTTCGTATAGCATACATTATACG
AAGTTATAGATCCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATAC
ATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAA
GTGCCACCTGACGTGGATCTCGAGCTCAAGCTTCGAATTCAGGGTTTCCTTGACAATATC
ATACTTATCCTGTCCCTTTTTTTTCCACAGCTACCGGTCGCGACTAGTATGGAAAAGAGA
AGATGGAAAAAGAATTTCATAGCCGTCTCAGCAGCCAACCGCTTTAAGAAAATCTCATCC
TCCGGGGCACTTGATTATGATATTCCAACTACTGCTAGCGAGAATTTGTATTTTCAGGGT
GAGCTCAAAACCGCGGCTCTTGCGCAACACGATGAAGCCGTGGACAACAAATTCAACAAA
GAACAACAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTAAACGAAGAACAACGA
AACGCCTTCATCCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGAA
GCTAAAAAGCTAAATGATGCTCAGGCGCCGAAAGTAGACAACAAATTCAACAAAGAACAA
CAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTAAACGAAGAACAACGAAACGCC
TTCATCCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAAA
AAGCTAAATGGTGCTCAGGCGCCGAAAGTAGACGCGAATTCCGCGGGGAAGTCAACCTGA
AGCTCTAGTTCTAGTCGACCATGAAGATCAAGATCATTGCCCCGCCAGAGCGCAAGTACT
CTGTCTGGATCGGTGGCTCCATCCTGGCTTCGCTGTCCACCTTCCAGCAGATGTGGATCT
CCAAGCAGGAGTACGACGAGTCCGGCCCCTCCATTGTGCACCGCAAGTGCTTCTAAGAAG
GATCGCTTGTCTGGGCAAGAGGATCAGGATCGGGATGGTCTTGATTCTGCTGGAGGAGGA
GGAGGAGAAGTCGAGGAAGCAGCAGCGAAAGTGCAAGTGCGAGTGGTGGAAGTTTGGAGT
GCAGCACAACAAAATCAACAACAACACCAACTACAAGATGAAAAGAGCGGAACCACCTGC
ACACCATCATCACTATCATCATCGTTTTGGGCGCATGTTGTGTGGTTCCAGCGTATTAAT
ATAATTAATTTATTCCACATGAGATATGATATGATATACTATGTATTTTTTGTTTTTTTT
TTATTTGTAAACCTTTAATATAACAAGAACTACAAAAAATGAAAATGAGCGAAAATGCAT
ATTCTGCCATTCCACACACACACCAACAACACCCAACACACGCACACCCACAAGCTTACA
CACACACATTCGCGGCATGACAAGGACATCAAGATAAAGAAGAACTTAAAGAAGATATTT
CCCAAAGCGCAAAAAGAACACACACACATTGCAAAACACAAACAACACACTAGCGTTTTG
TACAATTCGTCAGCAACCTTATGTATTATTTTTTAATTATGATGTAATTATAAACAAAGT
GAAACAAAAATATGAAAACAAAAAGGAAAATCAAATCTGTCTTCTCTTTCTCCCGCTCTC
CTCGCTCTCTGCTGCTAACCTCGCCCTCTCCTCTCTCATCTTTTTGTCTGTCTCTCTTCC
ACATTTTTGCCGGCCGGCAAAATAATAACCCACACACACTCACACTTGGCTGCAGTTTCG
CGTGCGATATTCACACACATTCAAGCATACAAGCATACATACATATGTATTTTTTTTTTA
TTTGTACACTTTTCTAATTGCATGCGTATCGATTGATAAGTTTACGCCTGAAAATGTTAA
TTAAAATGTGAAAATGCAACTGAAAAACTGATGAAATGAAACAACAACAAGCGAACAATT
TGCTACATGTGTATTGTCTAACAACCGTTACTGCAACGGTTGCTTCGGAAAAGGGTGAAG
AGGAAGAGGGCACGAGGTCGACTAGAGCGGCCGCCGACGCGAGGCTGGATGGCCTTCCCC
ATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATG

>pMK33-NFHis-BD, 8486 bases.
CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA
GGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCATTGGACCGCTGATCGTCACGGCG
ATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTA
TACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGA
ATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAAT
TCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCG
CCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGC
GCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTT
AGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTG
CGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGC
GGAAGTCAGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGAT
AACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCC
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGA
AGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTT
CTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTG
TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGC
GCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTG
GCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTC
TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTG
CTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACC
GCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCT
CAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGT
TAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAA
AAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAA
TGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCC
TGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCT
GCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCA
GCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT
AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTT
GCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCC
GGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC
TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTT
ATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACT
GGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGC
CCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATT
GGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCG
ATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCT
GGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAA
TGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGT
CTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGC
ACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACC
TATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCACATTTGTACGAATT
TTTTTTTTATCAAAAGTTCGAGTTTTTCACCAATTTCCTCATCAACCGAGCAAGGCAAAC
GGCTTTGAATAATATGGTGTTATATATACATATATCAAATCGCTGCTGACTGCGTGATTG
ATGGCCCCAAGATTACATATTATCGAATCAGGATTCAGAAGGAGATCAATGTCAAATGCG
GACAGGAACATGAAAGACGCCTGTTATGCGCAATTAAAAATTTGGGTTTAATTGCTGTGG
AAACTGTTGTTGGCGGCATCTTAAGTTCCTGTTTAACAACATCAACTACTTATGTACGTA
GAAGCGTTTAAGCCATTTGCATACAGATGAGAACTGGCTTTTGTGCTAATCAGTCAAGAT
GACTCCGATGATGATGACTCATTACCTGACCAGTTTTCGCTGCTTTCTTTTCAACAACTA
CTTGTATATGTATTGTATCCAATAGCAATACATTGAATTTCCATGGTCTAGTCACGTATT
ATCATTTAATTGACACCAAGTCGTGTTATTGTTGAGCTATCGAGTTCAGCTCAAACATTT
CTTATTCCCATGAATAAGCCGGCAAAAATATGCAATCTATGAAAGTTAATATAAGCAAAC
CTTACTTTGACTCAATACCAATGCACTTTGTGTCGATAGGTTCACGCAATTGAGGCGATT
ATTCCGATAACCCAAGCGATTGACTGTTCCCGTTTCGATTCCAATTGAAATTTGGAAATG
TACAATAGTTTTGCTATATGCTGTCAAGTACGCTCTTATCTTCTCTGGGTTTTCTTCAGA
GTTTCGAAACGCTTCTTCTTTTTTTTGTTTTTTTTTTTTTGGAATCTCGTATTTTGGAAG
GGGCTCCCCTCTGGAATTTGTTACACTGTCGTTATCATTGCGAACAAGCGGCCCGAAGCT
ATCAGCGACTTTAACATTTACAATGCACTTTTTTACGACCAATTAAATGTACATTTTCCT
TTCTTCGCCCGTTGATAAGCGAACGCGATGTGGCGCAGGCAATGTGTTGCTCTTGCGACA
CAAACGCAATCAAAATGGATTCAATTTCGCTTTTTCCCAGTGAAACGAAGAACGAACCGA
CCATCATGATATGCTCCTCTGCATGTTGCGTATTGAATCAATGACAATTTCAATTAAGCC
GCCCGTTCGTCATGCGTTTTCGTGCGCTTCGAAATGCTGATAACGCTGCTGTCCTCCAAC
TGCTTTGCATGTGGACACAATTCCATTTATTTAATTCTTTTATTTGGATCGGTTAAATTA
AAAAGCGCCTTGTTACGCATTTAACGTTGTTTCCGGTGCGTGGTGGTTTCATGCTTCTGG
GAACGGCAAATGGGTTTAGGATTGGGAACCCCTCATCATCTGTTGGAATATACTATTCAA
CCTACAAAAGTAACGTTAAACAACACTACTTTATATTTGATATGAATGGCCACACCTTTT
ATGCCATAAAACATATTGTAAGAGAATACCACTCTTTTTATTCCTTCTTTCCTTCTTGTA
CGTTTTTTGCTGTAAGTAGGTCGTGGTGCTGGTGTTGCAGTTGAAATAACTTAAAATATA
AATCATAAAACTCAAACATAAACTTGACTATTTATTTATTTATTAAGAAAGGAAATATAA
ATTATAAATTACAACAGGTTATGGACCTGCAGCCAAGCTTGGCGCTCGTCCGGGGGCAAT
GAGATATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGT
TCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCT
TCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACA
AAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTG
ACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCA
CGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCA
TGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGC
AAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATG
TGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCG
ATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATT
TCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCG
AGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGT
TGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGAT
CGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGG
TTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGAT
CCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCG
ATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGG
CAAAGGAATAGAGTAGATGCCGACCGAACAAGAGCTGATTTCGAGAACGCCTCAGCCAGC
AACTCGCGCGAGCCTAGCAAGGCAAATGCGAGAGAACGGCCTTACGCTTGGTGGCACAGT
TCTCGTCCACAGTTCGCTAAGCTCGCTCGGCTGGGTCGCGGGAGGGCCGGTCGCAGTGAT
TCAGGCCCTTCTGGATTGTGTTGGTCCCCAGGGCACGATTGTCATGCCCACGCACTCGGG
TGATCTGACTGATCCCGCAGATTGGAGATCGCCGCCCGTGCCTGCCGATTGGGTGCAGAT
CTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGAT
TTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCT
AATTGTTTGTGTATTTTAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGTGGAA
TGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGATGATGAGGC
TACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAA
GGACTTTCCTTCAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAACTCT
TGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGCACTGCTATACAAGAAAATTAT
GGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAACATACTGTT
TTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTCAAAAATTGTG
TACCTTTAGCTTTTTAATTTGTAAAGGGGTTAATAAGGAATATTTGATGTATAGTGCCTT
GACTAGAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACC
TCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGT
TTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAG
CATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATG
TCTGGATCAATTCGTTGCAGGACAGGATGTGGTGCCCGATGTGACTAGCTCTTTGCTGCA
GGCCGTCCTATCCTCTGGTTCCGATAAGAGACCCAGAACTCCGGCCCCCCACCGCCCACC
GCCACCCCCATACATATGTGGTACGCAAGTAAGAGTGCCTGCGCATGCCCCATGTGCCCC
ACCAAGAGCTTTGCATCCCATACAAGTCCCCAAAGTGGAGAACCGAACCAATTCTTCGCG
GGCAGAACAAAAGCTTCTGCACACGTCTCCACTCGAATTTGGAGCCGGCCGGCGTGTGCA
AAAGAGGTGAATCGAACGAAAGACCCGTGTGTAAAGCCGCGTTTCCAAAATGTATAAAAC
CGAGAGCATCTGGCCAATGTGCATCAGTTGTGGTCAGCAGCAAAATCAAGTGAATCATCT
CAGTGCAACTAAAGGGGGGATCTCGAGAACATGGACTACAAAGACCATGACGGTGATTAT
AAAGATCATGACATCGACTACAAGGATGACGATGACAAGGGCGGCCGGCATCATCACCAT
CACCATAGATCCATAACTTCGTATAGCATACATTATACGAAGTTATAGATCCAATATTAT
TGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAA
AATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTACTAGTT
CTAGTCGACCATGAAGATCAAGATCATTGCCCCGCCAGAGCGCAAGTACTCTGTCTGGAT
CGGTGGCTCCATCCTGGCTTCGCTGTCCACCTTCCAGCAGATGTGGATCTCCAAGCAGGA
GTACGACGAGTCCGGCCCCTCCATTGTGCACCGCAAGTGCTTCTAAGAAGGATCGCTTGT
CTGGGCAAGAGGATCAGGATCGGGATGGTCTTGATTCTGCTGGAGGAGGAGGAGGAGAAG
TCGAGGAAGCAGCAGCGAAAGTGCAAGTGCGAGTGGTGGAAGTTTGGAGTGCAGCACAAC
AAAATCAACAACAACACCAACTACAAGATGAAAAGAGCGGAACCACCTGCACACCATCAT
CACTATCATCATCGTTTTGGGCGCATGTTGTGTGGTTCCAGCGTATTAATATAATTAATT
TATTCCACATGAGATATGATATGATATACTATGTATTTTTTGTTTTTTTTTTATTTGTAA
ACCTTTAATATAACAAGAACTACAAAAAATGAAAATGAGCGAAAATGCATATTCTGCCAT
TCCACACACACACCAACAACACCCAACACACGCACACCCACAAGCTTACACACACACATT
CGCGGCATGACAAGGACATCAAGATAAAGAAGAACTTAAAGAAGATATTTCCCAAAGCGC
AAAAAGAACACACACACATTGCAAAACACAAACAACACACTAGCGTTTTGTACAATTCGT
CAGCAACCTTATGTATTATTTTTTAATTATGATGTAATTATAAACAAAGTGAAACAAAAA
TATGAAAACAAAAAGGAAAATCAAATCTGTCTTCTCTTTCTCCCGCTCTCCTCGCTCTCT
GCTGCTAACCTCGCCCTCTCCTCTCTCATCTTTTTGTCTGTCTCTCTTCCACATTTTTGC
CGGCCGGCAAAATAATAACCCACACACACTCACACTTGGCTGCAGTTTCGCGTGCGATAT
TCACACACATTCAAGCATACAAGCATACATACATATGTATTTTTTTTTTATTTGTACACT
TTTCTAATTGCATGCGTATCGATTGATAAGTTTACGCCTGAAAATGTTAATTAAAATGTG
AAAATGCAACTGAAAAACTGATGAAATGAAACAACAACAAGCGAACAATTTGCTACATGT
GTATTGTCTAACAACCGTTACTGCAACGGTTGCTTCGGAAAAGGGTGAAGAGGAAGAGGG
CACGAGGTCGACTAGAGCGGCCGCCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTC
TTCTCGCTTCCGGCGGCATCGGGATG

>pMK33-CSG-BD, 9054 bases.
CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA
GGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCATTGGACCGCTGATCGTCACGGCG
ATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTA
TACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGA
ATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAAT
TCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCG
CCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGC
GCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTT
AGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTG
CGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGC
GGAAGTCAGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGAT
AACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCC
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGA
AGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTT
CTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTG
TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGC
GCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTG
GCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTC
TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTG
CTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACC
GCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCT
CAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGT
TAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAA
AAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAA
TGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCC
TGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCT
GCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCA
GCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT
AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTT
GCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCC
GGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC
TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTT
ATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACT
GGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGC
CCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATT
GGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCG
ATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCT
GGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAA
TGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGT
CTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGC
ACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACC
TATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCACATTTGTACGAATT
TTTTTTTTATCAAAAGTTCGAGTTTTTCACCAATTTCCTCATCAACCGAGCAAGGCAAAC
GGCTTTGAATAATATGGTGTTATATATACATATATCAAATCGCTGCTGACTGCGTGATTG
ATGGCCCCAAGATTACATATTATCGAATCAGGATTCAGAAGGAGATCAATGTCAAATGCG
GACAGGAACATGAAAGACGCCTGTTATGCGCAATTAAAAATTTGGGTTTAATTGCTGTGG
AAACTGTTGTTGGCGGCATCTTAAGTTCCTGTTTAACAACATCAACTACTTATGTACGTA
GAAGCGTTTAAGCCATTTGCATACAGATGAGAACTGGCTTTTGTGCTAATCAGTCAAGAT
GACTCCGATGATGATGACTCATTACCTGACCAGTTTTCGCTGCTTTCTTTTCAACAACTA
CTTGTATATGTATTGTATCCAATAGCAATACATTGAATTTCCATGGTCTAGTCACGTATT
ATCATTTAATTGACACCAAGTCGTGTTATTGTTGAGCTATCGAGTTCAGCTCAAACATTT
CTTATTCCCATGAATAAGCCGGCAAAAATATGCAATCTATGAAAGTTAATATAAGCAAAC
CTTACTTTGACTCAATACCAATGCACTTTGTGTCGATAGGTTCACGCAATTGAGGCGATT
ATTCCGATAACCCAAGCGATTGACTGTTCCCGTTTCGATTCCAATTGAAATTTGGAAATG
TACAATAGTTTTGCTATATGCTGTCAAGTACGCTCTTATCTTCTCTGGGTTTTCTTCAGA
GTTTCGAAACGCTTCTTCTTTTTTTTGTTTTTTTTTTTTTGGAATCTCGTATTTTGGAAG
GGGCTCCCCTCTGGAATTTGTTACACTGTCGTTATCATTGCGAACAAGCGGCCCGAAGCT
ATCAGCGACTTTAACATTTACAATGCACTTTTTTACGACCAATTAAATGTACATTTTCCT
TTCTTCGCCCGTTGATAAGCGAACGCGATGTGGCGCAGGCAATGTGTTGCTCTTGCGACA
CAAACGCAATCAAAATGGATTCAATTTCGCTTTTTCCCAGTGAAACGAAGAACGAACCGA
CCATCATGATATGCTCCTCTGCATGTTGCGTATTGAATCAATGACAATTTCAATTAAGCC
GCCCGTTCGTCATGCGTTTTCGTGCGCTTCGAAATGCTGATAACGCTGCTGTCCTCCAAC
TGCTTTGCATGTGGACACAATTCCATTTATTTAATTCTTTTATTTGGATCGGTTAAATTA
AAAAGCGCCTTGTTACGCATTTAACGTTGTTTCCGGTGCGTGGTGGTTTCATGCTTCTGG
GAACGGCAAATGGGTTTAGGATTGGGAACCCCTCATCATCTGTTGGAATATACTATTCAA
CCTACAAAAGTAACGTTAAACAACACTACTTTATATTTGATATGAATGGCCACACCTTTT
ATGCCATAAAACATATTGTAAGAGAATACCACTCTTTTTATTCCTTCTTTCCTTCTTGTA
CGTTTTTTGCTGTAAGTAGGTCGTGGTGCTGGTGTTGCAGTTGAAATAACTTAAAATATA
AATCATAAAACTCAAACATAAACTTGACTATTTATTTATTTATTAAGAAAGGAAATATAA
ATTATAAATTACAACAGGTTATGGACCTGCAGCCAAGCTTGGCGCTCGTCCGGGGGCAAT
GAGATATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGT
TCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCT
TCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACA
AAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTG
ACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCA
CGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCA
TGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGC
AAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATG
TGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCG
ATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATT
TCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCG
AGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGT
TGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGAT
CGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGG
TTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGAT
CCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCG
ATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGG
CAAAGGAATAGAGTAGATGCCGACCGAACAAGAGCTGATTTCGAGAACGCCTCAGCCAGC
AACTCGCGCGAGCCTAGCAAGGCAAATGCGAGAGAACGGCCTTACGCTTGGTGGCACAGT
TCTCGTCCACAGTTCGCTAAGCTCGCTCGGCTGGGTCGCGGGAGGGCCGGTCGCAGTGAT
TCAGGCCCTTCTGGATTGTGTTGGTCCCCAGGGCACGATTGTCATGCCCACGCACTCGGG
TGATCTGACTGATCCCGCAGATTGGAGATCGCCGCCCGTGCCTGCCGATTGGGTGCAGAT
CTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGAT
TTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCT
AATTGTTTGTGTATTTTAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGTGGAA
TGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGATGATGAGGC
TACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAA
GGACTTTCCTTCAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAACTCT
TGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGCACTGCTATACAAGAAAATTAT
GGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAACATACTGTT
TTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTCAAAAATTGTG
TACCTTTAGCTTTTTAATTTGTAAAGGGGTTAATAAGGAATATTTGATGTATAGTGCCTT
GACTAGAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACC
TCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGT
TTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAG
CATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATG
TCTGGATCAATTCGTTGCAGGACAGGATGTGGTGCCCGATGTGACTAGCTCTTTGCTGCA
GGCCGTCCTATCCTCTGGTTCCGATAAGAGACCCAGAACTCCGGCCCCCCACCGCCCACC
GCCACCCCCATACATATGTGGTACGCAAGTAAGAGTGCCTGCGCATGCCCCATGTGCCCC
ACCAAGAGCTTTGCATCCCATACAAGTCCCCAAAGTGGAGAACCGAACCAATTCTTCGCG
GGCAGAACAAAAGCTTCTGCACACGTCTCCACTCGAATTTGGAGCCGGCCGGCGTGTGCA
AAAGAGGTGAATCGAACGAAAGACCCGTGTGTAAAGCCGCGTTTCCAAAATGTATAAAAC
CGAGAGCATCTGGCCAATGTGCATCAGTTGTGGTCAGCAGCAAAATCAAGTGAATCATCT
CAGTGCAACTAAAGGGGGGATCTCGAGGGATCCATAACTTCGTATAGCATACATTATACG
AAGTTATAGATCCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATAC
ATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAA
GTGCCACCTGACGTGGATCTCGAGCTCAAGCTTCGAATTCAGGGTTTCCTTGACAATATC
ATACTTATCCTGTCCCTTTTTTTTCCACAGCTACCGGTCGCGACTAGTGAGCAGAAGCTT
ATCTCCGAGGAGGATCTCATGGACGAGAAGACCACCGGGTGGCGGGGCGGCCACGTTGTG
GAGGGTCTCGCTGGCGAGCTGGAGCAGCTCAGGGCCCGCTTGGAGCACCATCCCCAGGGG
CAACGCGAGCCTATCGATGAAAATCTGTACTTCCAGGGGATCGATGAGAACCTGTACTTT
CAGGGGGGTAGTACCCCGGCCGTGACGACCTACAAGCTGGTGATCAACGGCAAGACCCTG
AAGGGCGAGACCACAACCAAGGCCGTGGACGCTGAAACCGCAGAGAAGGCCTTCAAGCAG
TACGCCAACGACAATGGCGTGGACGGAGTGTGGACCTACGACGATGCCACCAAGACCTTC
ACCGTGACCGAGGTTAACACCCCCGCAGTCACCACATACAAACTGGTGATCAACGGAAAA
ACGCTGAAGGGCGAAACTACGACCAAGGCTGTGGACGCGGAGACGGCCGAAAAGGCGTTC
AAACAGTATGCCAACGATAACGGTGTAGACGGCGTCTGGACATATGACGACGCGACAAAG
ACTTTCACTGTCACTGAATAGACTAGTTCTAGTCGACCATGAAGATCAAGATCATTGCCC
CGCCAGAGCGCAAGTACTCTGTCTGGATCGGTGGCTCCATCCTGGCTTCGCTGTCCACCT
TCCAGCAGATGTGGATCTCCAAGCAGGAGTACGACGAGTCCGGCCCCTCCATTGTGCACC
GCAAGTGCTTCTAAGAAGGATCGCTTGTCTGGGCAAGAGGATCAGGATCGGGATGGTCTT
GATTCTGCTGGAGGAGGAGGAGGAGAAGTCGAGGAAGCAGCAGCGAAAGTGCAAGTGCGA
GTGGTGGAAGTTTGGAGTGCAGCACAACAAAATCAACAACAACACCAACTACAAGATGAA
AAGAGCGGAACCACCTGCACACCATCATCACTATCATCATCGTTTTGGGCGCATGTTGTG
TGGTTCCAGCGTATTAATATAATTAATTTATTCCACATGAGATATGATATGATATACTAT
GTATTTTTTGTTTTTTTTTTATTTGTAAACCTTTAATATAACAAGAACTACAAAAAATGA
AAATGAGCGAAAATGCATATTCTGCCATTCCACACACACACCAACAACACCCAACACACG
CACACCCACAAGCTTACACACACACATTCGCGGCATGACAAGGACATCAAGATAAAGAAG
AACTTAAAGAAGATATTTCCCAAAGCGCAAAAAGAACACACACACATTGCAAAACACAAA
CAACACACTAGCGTTTTGTACAATTCGTCAGCAACCTTATGTATTATTTTTTAATTATGA
TGTAATTATAAACAAAGTGAAACAAAAATATGAAAACAAAAAGGAAAATCAAATCTGTCT
TCTCTTTCTCCCGCTCTCCTCGCTCTCTGCTGCTAACCTCGCCCTCTCCTCTCTCATCTT
TTTGTCTGTCTCTCTTCCACATTTTTGCCGGCCGGCAAAATAATAACCCACACACACTCA
CACTTGGCTGCAGTTTCGCGTGCGATATTCACACACATTCAAGCATACAAGCATACATAC
ATATGTATTTTTTTTTTATTTGTACACTTTTCTAATTGCATGCGTATCGATTGATAAGTT
TACGCCTGAAAATGTTAATTAAAATGTGAAAATGCAACTGAAAAACTGATGAAATGAAAC
AACAACAAGCGAACAATTTGCTACATGTGTATTGTCTAACAACCGTTACTGCAACGGTTG
CTTCGGAAAAGGGTGAAGAGGAAGAGGGCACGAGGTCGACTAGAGCGGCCGCCGACGCGA
GGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATG

>pMK33-CK-BD, 8616 bases.
CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA
GGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCATTGGACCGCTGATCGTCACGGCG
ATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTA
TACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGA
ATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAAT
TCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCG
CCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGC
GCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTT
AGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTG
CGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGC
GGAAGTCAGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGAT
AACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCC
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGA
AGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTT
CTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTG
TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGC
GCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTG
GCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTC
TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTG
CTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACC
GCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCT
CAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGT
TAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAA
AAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAA
TGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCC
TGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCT
GCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCA
GCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT
AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTT
GCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCC
GGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC
TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTT
ATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACT
GGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGC
CCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATT
GGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCG
ATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCT
GGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAA
TGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGT
CTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGC
ACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACC
TATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCACATTTGTACGAATT
TTTTTTTTATCAAAAGTTCGAGTTTTTCACCAATTTCCTCATCAACCGAGCAAGGCAAAC
GGCTTTGAATAATATGGTGTTATATATACATATATCAAATCGCTGCTGACTGCGTGATTG
ATGGCCCCAAGATTACATATTATCGAATCAGGATTCAGAAGGAGATCAATGTCAAATGCG
GACAGGAACATGAAAGACGCCTGTTATGCGCAATTAAAAATTTGGGTTTAATTGCTGTGG
AAACTGTTGTTGGCGGCATCTTAAGTTCCTGTTTAACAACATCAACTACTTATGTACGTA
GAAGCGTTTAAGCCATTTGCATACAGATGAGAACTGGCTTTTGTGCTAATCAGTCAAGAT
GACTCCGATGATGATGACTCATTACCTGACCAGTTTTCGCTGCTTTCTTTTCAACAACTA
CTTGTATATGTATTGTATCCAATAGCAATACATTGAATTTCCATGGTCTAGTCACGTATT
ATCATTTAATTGACACCAAGTCGTGTTATTGTTGAGCTATCGAGTTCAGCTCAAACATTT
CTTATTCCCATGAATAAGCCGGCAAAAATATGCAATCTATGAAAGTTAATATAAGCAAAC
CTTACTTTGACTCAATACCAATGCACTTTGTGTCGATAGGTTCACGCAATTGAGGCGATT
ATTCCGATAACCCAAGCGATTGACTGTTCCCGTTTCGATTCCAATTGAAATTTGGAAATG
TACAATAGTTTTGCTATATGCTGTCAAGTACGCTCTTATCTTCTCTGGGTTTTCTTCAGA
GTTTCGAAACGCTTCTTCTTTTTTTTGTTTTTTTTTTTTTGGAATCTCGTATTTTGGAAG
GGGCTCCCCTCTGGAATTTGTTACACTGTCGTTATCATTGCGAACAAGCGGCCCGAAGCT
ATCAGCGACTTTAACATTTACAATGCACTTTTTTACGACCAATTAAATGTACATTTTCCT
TTCTTCGCCCGTTGATAAGCGAACGCGATGTGGCGCAGGCAATGTGTTGCTCTTGCGACA
CAAACGCAATCAAAATGGATTCAATTTCGCTTTTTCCCAGTGAAACGAAGAACGAACCGA
CCATCATGATATGCTCCTCTGCATGTTGCGTATTGAATCAATGACAATTTCAATTAAGCC
GCCCGTTCGTCATGCGTTTTCGTGCGCTTCGAAATGCTGATAACGCTGCTGTCCTCCAAC
TGCTTTGCATGTGGACACAATTCCATTTATTTAATTCTTTTATTTGGATCGGTTAAATTA
AAAAGCGCCTTGTTACGCATTTAACGTTGTTTCCGGTGCGTGGTGGTTTCATGCTTCTGG
GAACGGCAAATGGGTTTAGGATTGGGAACCCCTCATCATCTGTTGGAATATACTATTCAA
CCTACAAAAGTAACGTTAAACAACACTACTTTATATTTGATATGAATGGCCACACCTTTT
ATGCCATAAAACATATTGTAAGAGAATACCACTCTTTTTATTCCTTCTTTCCTTCTTGTA
CGTTTTTTGCTGTAAGTAGGTCGTGGTGCTGGTGTTGCAGTTGAAATAACTTAAAATATA
AATCATAAAACTCAAACATAAACTTGACTATTTATTTATTTATTAAGAAAGGAAATATAA
ATTATAAATTACAACAGGTTATGGACCTGCAGCCAAGCTTGGCGCTCGTCCGGGGGCAAT
GAGATATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGT
TCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCT
TCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACA
AAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTG
ACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCA
CGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCA
TGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGC
AAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATG
TGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCG
ATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATT
TCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCG
AGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGT
TGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGAT
CGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGG
TTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGAT
CCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCG
ATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGG
CAAAGGAATAGAGTAGATGCCGACCGAACAAGAGCTGATTTCGAGAACGCCTCAGCCAGC
AACTCGCGCGAGCCTAGCAAGGCAAATGCGAGAGAACGGCCTTACGCTTGGTGGCACAGT
TCTCGTCCACAGTTCGCTAAGCTCGCTCGGCTGGGTCGCGGGAGGGCCGGTCGCAGTGAT
TCAGGCCCTTCTGGATTGTGTTGGTCCCCAGGGCACGATTGTCATGCCCACGCACTCGGG
TGATCTGACTGATCCCGCAGATTGGAGATCGCCGCCCGTGCCTGCCGATTGGGTGCAGAT
CTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGAT
TTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCT
AATTGTTTGTGTATTTTAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGTGGAA
TGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGATGATGAGGC
TACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAA
GGACTTTCCTTCAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAACTCT
TGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGCACTGCTATACAAGAAAATTAT
GGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAACATACTGTT
TTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTCAAAAATTGTG
TACCTTTAGCTTTTTAATTTGTAAAGGGGTTAATAAGGAATATTTGATGTATAGTGCCTT
GACTAGAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACC
TCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGT
TTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAG
CATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATG
TCTGGATCAATTCGTTGCAGGACAGGATGTGGTGCCCGATGTGACTAGCTCTTTGCTGCA
GGCCGTCCTATCCTCTGGTTCCGATAAGAGACCCAGAACTCCGGCCCCCCACCGCCCACC
GCCACCCCCATACATATGTGGTACGCAAGTAAGAGTGCCTGCGCATGCCCCATGTGCCCC
ACCAAGAGCTTTGCATCCCATACAAGTCCCCAAAGTGGAGAACCGAACCAATTCTTCGCG
GGCAGAACAAAAGCTTCTGCACACGTCTCCACTCGAATTTGGAGCCGGCCGGCGTGTGCA
AAAGAGGTGAATCGAACGAAAGACCCGTGTGTAAAGCCGCGTTTCCAAAATGTATAAAAC
CGAGAGCATCTGGCCAATGTGCATCAGTTGTGGTCAGCAGCAAAATCAAGTGAATCATCT
CAGTGCAACTAAAGGGGGGATCTCGAGGGATCCATAACTTCGTATAGCATACATTATACG
AAGTTATAGATCCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATAC
ATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAA
GTGCCACCTGACGTGGATCTCGAGCTCAAGCTTCGAATTCAGGGTTTCCTTGACAATATC
ATACTTATCCTGTCCCTTTTTTTTCCACAGCTACCGGTCGCGactagtGACTACAAAGAC
CATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAGGAGAAC
CTGTACTTCCAGTCCAACTGGAGCCACCCGCAGTTCGAAAAGCATCACCATCACCATCAC
TAAACTAGTtCTAGTCGACCATGAAGATCAAGATCATTGCCCCGCCAGAGCGCAAGTACT
CTGTCTGGATCGGTGGCTCCATCCTGGCTTCGCTGTCCACCTTCCAGCAGATGTGGATCT
CCAAGCAGGAGTACGACGAGTCCGGCCCCTCCATTGTGCACCGCAAGTGCTTCTAAGAAG
GATCGCTTGTCTGGGCAAGAGGATCAGGATCGGGATGGTCTTGATTCTGCTGGAGGAGGA
GGAGGAGAAGTCGAGGAAGCAGCAGCGAAAGTGCAAGTGCGAGTGGTGGAAGTTTGGAGT
GCAGCACAACAAAATCAACAACAACACCAACTACAAGATGAAAAGAGCGGAACCACCTGC
ACACCATCATCACTATCATCATCGTTTTGGGCGCATGTTGTGTGGTTCCAGCGTATTAAT
ATAATTAATTTATTCCACATGAGATATGATATGATATACTATGTATTTTTTGTTTTTTTT
TTATTTGTAAACCTTTAATATAACAAGAACTACAAAAAATGAAAATGAGCGAAAATGCAT
ATTCTGCCATTCCACACACACACCAACAACACCCAACACACGCACACCCACAAGCTTACA
CACACACATTCGCGGCATGACAAGGACATCAAGATAAAGAAGAACTTAAAGAAGATATTT
CCCAAAGCGCAAAAAGAACACACACACATTGCAAAACACAAACAACACACTAGCGTTTTG
TACAATTCGTCAGCAACCTTATGTATTATTTTTTAATTATGATGTAATTATAAACAAAGT
GAAACAAAAATATGAAAACAAAAAGGAAAATCAAATCTGTCTTCTCTTTCTCCCGCTCTC
CTCGCTCTCTGCTGCTAACCTCGCCCTCTCCTCTCTCATCTTTTTGTCTGTCTCTCTTCC
ACATTTTTGCCGGCCGGCAAAATAATAACCCACACACACTCACACTTGGCTGCAGTTTCG
CGTGCGATATTCACACACATTCAAGCATACAAGCATACATACATATGTATTTTTTTTTTA
TTTGTACACTTTTCTAATTGCATGCGTATCGATTGATAAGTTTACGCCTGAAAATGTTAA
TTAAAATGTGAAAATGCAACTGAAAAACTGATGAAATGAAACAACAACAAGCGAACAATT
TGCTACATGTGTATTGTCTAACAACCGTTACTGCAACGGTTGCTTCGGAAAAGGGTGAAG
AGGAAGAGGGCACGAGGTCGACTAGAGCGGCCGCCGACGCGAGGCTGGATGGCCTTCCCC
ATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATG

>pMK33-NFH-BD, 8459 bases.
CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA
GGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCATTGGACCGCTGATCGTCACGGCG
ATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTA
TACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGA
ATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAAT
TCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCG
CCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGC
GCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTT
AGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTG
CGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGC
GGAAGTCAGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGAT
AACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCC
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGA
AGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTT
CTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTG
TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGC
GCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTG
GCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTC
TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTG
CTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACC
GCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCT
CAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGT
TAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAA
AAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAA
TGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCC
TGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCT
GCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCA
GCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT
AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTT
GCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCC
GGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC
TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTT
ATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACT
GGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGC
CCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATT
GGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCG
ATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCT
GGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAA
TGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGT
CTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGC
ACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACC
TATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCACATTTGTACGAATT
TTTTTTTTATCAAAAGTTCGAGTTTTTCACCAATTTCCTCATCAACCGAGCAAGGCAAAC
GGCTTTGAATAATATGGTGTTATATATACATATATCAAATCGCTGCTGACTGCGTGATTG
ATGGCCCCAAGATTACATATTATCGAATCAGGATTCAGAAGGAGATCAATGTCAAATGCG
GACAGGAACATGAAAGACGCCTGTTATGCGCAATTAAAAATTTGGGTTTAATTGCTGTGG
AAACTGTTGTTGGCGGCATCTTAAGTTCCTGTTTAACAACATCAACTACTTATGTACGTA
GAAGCGTTTAAGCCATTTGCATACAGATGAGAACTGGCTTTTGTGCTAATCAGTCAAGAT
GACTCCGATGATGATGACTCATTACCTGACCAGTTTTCGCTGCTTTCTTTTCAACAACTA
CTTGTATATGTATTGTATCCAATAGCAATACATTGAATTTCCATGGTCTAGTCACGTATT
ATCATTTAATTGACACCAAGTCGTGTTATTGTTGAGCTATCGAGTTCAGCTCAAACATTT
CTTATTCCCATGAATAAGCCGGCAAAAATATGCAATCTATGAAAGTTAATATAAGCAAAC
CTTACTTTGACTCAATACCAATGCACTTTGTGTCGATAGGTTCACGCAATTGAGGCGATT
ATTCCGATAACCCAAGCGATTGACTGTTCCCGTTTCGATTCCAATTGAAATTTGGAAATG
TACAATAGTTTTGCTATATGCTGTCAAGTACGCTCTTATCTTCTCTGGGTTTTCTTCAGA
GTTTCGAAACGCTTCTTCTTTTTTTTGTTTTTTTTTTTTTGGAATCTCGTATTTTGGAAG
GGGCTCCCCTCTGGAATTTGTTACACTGTCGTTATCATTGCGAACAAGCGGCCCGAAGCT
ATCAGCGACTTTAACATTTACAATGCACTTTTTTACGACCAATTAAATGTACATTTTCCT
TTCTTCGCCCGTTGATAAGCGAACGCGATGTGGCGCAGGCAATGTGTTGCTCTTGCGACA
CAAACGCAATCAAAATGGATTCAATTTCGCTTTTTCCCAGTGAAACGAAGAACGAACCGA
CCATCATGATATGCTCCTCTGCATGTTGCGTATTGAATCAATGACAATTTCAATTAAGCC
GCCCGTTCGTCATGCGTTTTCGTGCGCTTCGAAATGCTGATAACGCTGCTGTCCTCCAAC
TGCTTTGCATGTGGACACAATTCCATTTATTTAATTCTTTTATTTGGATCGGTTAAATTA
AAAAGCGCCTTGTTACGCATTTAACGTTGTTTCCGGTGCGTGGTGGTTTCATGCTTCTGG
GAACGGCAAATGGGTTTAGGATTGGGAACCCCTCATCATCTGTTGGAATATACTATTCAA
CCTACAAAAGTAACGTTAAACAACACTACTTTATATTTGATATGAATGGCCACACCTTTT
ATGCCATAAAACATATTGTAAGAGAATACCACTCTTTTTATTCCTTCTTTCCTTCTTGTA
CGTTTTTTGCTGTAAGTAGGTCGTGGTGCTGGTGTTGCAGTTGAAATAACTTAAAATATA
AATCATAAAACTCAAACATAAACTTGACTATTTATTTATTTATTAAGAAAGGAAATATAA
ATTATAAATTACAACAGGTTATGGACCTGCAGCCAAGCTTGGCGCTCGTCCGGGGGCAAT
GAGATATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGT
TCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCT
TCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACA
AAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTG
ACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCA
CGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCA
TGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGC
AAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATG
TGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCG
ATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATT
TCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCG
AGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGT
TGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGAT
CGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGG
TTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGAT
CCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCG
ATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGG
CAAAGGAATAGAGTAGATGCCGACCGAACAAGAGCTGATTTCGAGAACGCCTCAGCCAGC
AACTCGCGCGAGCCTAGCAAGGCAAATGCGAGAGAACGGCCTTACGCTTGGTGGCACAGT
TCTCGTCCACAGTTCGCTAAGCTCGCTCGGCTGGGTCGCGGGAGGGCCGGTCGCAGTGAT
TCAGGCCCTTCTGGATTGTGTTGGTCCCCAGGGCACGATTGTCATGCCCACGCACTCGGG
TGATCTGACTGATCCCGCAGATTGGAGATCGCCGCCCGTGCCTGCCGATTGGGTGCAGAT
CTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGAT
TTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCT
AATTGTTTGTGTATTTTAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGTGGAA
TGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGATGATGAGGC
TACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAA
GGACTTTCCTTCAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAACTCT
TGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGCACTGCTATACAAGAAAATTAT
GGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAACATACTGTT
TTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTCAAAAATTGTG
TACCTTTAGCTTTTTAATTTGTAAAGGGGTTAATAAGGAATATTTGATGTATAGTGCCTT
GACTAGAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACC
TCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGT
TTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAG
CATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATG
TCTGGATCAATTCGTTGCAGGACAGGATGTGGTGCCCGATGTGACTAGCTCTTTGCTGCA
GGCCGTCCTATCCTCTGGTTCCGATAAGAGACCCAGAACTCCGGCCCCCCACCGCCCACC
GCCACCCCCATACATATGTGGTACGCAAGTAAGAGTGCCTGCGCATGCCCCATGTGCCCC
ACCAAGAGCTTTGCATCCCATACAAGTCCCCAAAGTGGAGAACCGAACCAATTCTTCGCG
GGCAGAACAAAAGCTTCTGCACACGTCTCCACTCGAATTTGGAGCCGGCCGGCGTGTGCA
AAAGAGGTGAATCGAACGAAAGACCCGTGTGTAAAGCCGCGTTTCCAAAATGTATAAAAC
CGAGAGCATCTGGCCAATGTGCATCAGTTGTGGTCAGCAGCAAAATCAAGTGAATCATCT
CAGTGCAACTAAAGGGGGGATCTCGAGAACATGGACTACAAAGACGATGACGACAAGGTC
AAACTTTACCCATACGATGTTCCAGATTACGCTGCTGCTGGATCCATAACTTCGTATAGC
ATACATTATACGAAGTTATAGATCCAATATTATTGAAGCATTTATCAGGGTTATTGTCTC
ATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACA
TTTCCCCGAAAAGTGCCACCTGACGTACTAGTTCTAGTCGACCATGAAGATCAAGATCAT
TGCCCCGCCAGAGCGCAAGTACTCTGTCTGGATCGGTGGCTCCATCCTGGCTTCGCTGTC
CACCTTCCAGCAGATGTGGATCTCCAAGCAGGAGTACGACGAGTCCGGCCCCTCCATTGT
GCACCGCAAGTGCTTCTAAGAAGGATCGCTTGTCTGGGCAAGAGGATCAGGATCGGGATG
GTCTTGATTCTGCTGGAGGAGGAGGAGGAGAAGTCGAGGAAGCAGCAGCGAAAGTGCAAG
TGCGAGTGGTGGAAGTTTGGAGTGCAGCACAACAAAATCAACAACAACACCAACTACAAG
ATGAAAAGAGCGGAACCACCTGCACACCATCATCACTATCATCATCGTTTTGGGCGCATG
TTGTGTGGTTCCAGCGTATTAATATAATTAATTTATTCCACATGAGATATGATATGATAT
ACTATGTATTTTTTGTTTTTTTTTTATTTGTAAACCTTTAATATAACAAGAACTACAAAA
AATGAAAATGAGCGAAAATGCATATTCTGCCATTCCACACACACACCAACAACACCCAAC
ACACGCACACCCACAAGCTTACACACACACATTCGCGGCATGACAAGGACATCAAGATAA
AGAAGAACTTAAAGAAGATATTTCCCAAAGCGCAAAAAGAACACACACACATTGCAAAAC
ACAAACAACACACTAGCGTTTTGTACAATTCGTCAGCAACCTTATGTATTATTTTTTAAT
TATGATGTAATTATAAACAAAGTGAAACAAAAATATGAAAACAAAAAGGAAAATCAAATC
TGTCTTCTCTTTCTCCCGCTCTCCTCGCTCTCTGCTGCTAACCTCGCCCTCTCCTCTCTC
ATCTTTTTGTCTGTCTCTCTTCCACATTTTTGCCGGCCGGCAAAATAATAACCCACACAC
ACTCACACTTGGCTGCAGTTTCGCGTGCGATATTCACACACATTCAAGCATACAAGCATA
CATACATATGTATTTTTTTTTTATTTGTACACTTTTCTAATTGCATGCGTATCGATTGAT
AAGTTTACGCCTGAAAATGTTAATTAAAATGTGAAAATGCAACTGAAAAACTGATGAAAT
GAAACAACAACAAGCGAACAATTTGCTACATGTGTATTGTCTAACAACCGTTACTGCAAC
GGTTGCTTCGGAAAAGGGTGAAGAGGAAGAGGGCACGAGGTCGACTAGAGCGGCCGCCGA
CGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATG

>pMK33-CFH-BD, 8550 bases.
CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA
GGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCATTGGACCGCTGATCGTCACGGCG
ATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTA
TACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGA
ATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAAT
TCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCG
CCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGC
GCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTT
AGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTG
CGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGC
GGAAGTCAGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGAT
AACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCC
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGA
AGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTT
CTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTG
TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGC
GCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTG
GCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTC
TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTG
CTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACC
GCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCT
CAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGT
TAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAA
AAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAA
TGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCC
TGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCT
GCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCA
GCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT
AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTT
GCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCC
GGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC
TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTT
ATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACT
GGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGC
CCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATT
GGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCG
ATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCT
GGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAA
TGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGT
CTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGC
ACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACC
TATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCACATTTGTACGAATT
TTTTTTTTATCAAAAGTTCGAGTTTTTCACCAATTTCCTCATCAACCGAGCAAGGCAAAC
GGCTTTGAATAATATGGTGTTATATATACATATATCAAATCGCTGCTGACTGCGTGATTG
ATGGCCCCAAGATTACATATTATCGAATCAGGATTCAGAAGGAGATCAATGTCAAATGCG
GACAGGAACATGAAAGACGCCTGTTATGCGCAATTAAAAATTTGGGTTTAATTGCTGTGG
AAACTGTTGTTGGCGGCATCTTAAGTTCCTGTTTAACAACATCAACTACTTATGTACGTA
GAAGCGTTTAAGCCATTTGCATACAGATGAGAACTGGCTTTTGTGCTAATCAGTCAAGAT
GACTCCGATGATGATGACTCATTACCTGACCAGTTTTCGCTGCTTTCTTTTCAACAACTA
CTTGTATATGTATTGTATCCAATAGCAATACATTGAATTTCCATGGTCTAGTCACGTATT
ATCATTTAATTGACACCAAGTCGTGTTATTGTTGAGCTATCGAGTTCAGCTCAAACATTT
CTTATTCCCATGAATAAGCCGGCAAAAATATGCAATCTATGAAAGTTAATATAAGCAAAC
CTTACTTTGACTCAATACCAATGCACTTTGTGTCGATAGGTTCACGCAATTGAGGCGATT
ATTCCGATAACCCAAGCGATTGACTGTTCCCGTTTCGATTCCAATTGAAATTTGGAAATG
TACAATAGTTTTGCTATATGCTGTCAAGTACGCTCTTATCTTCTCTGGGTTTTCTTCAGA
GTTTCGAAACGCTTCTTCTTTTTTTTGTTTTTTTTTTTTTGGAATCTCGTATTTTGGAAG
GGGCTCCCCTCTGGAATTTGTTACACTGTCGTTATCATTGCGAACAAGCGGCCCGAAGCT
ATCAGCGACTTTAACATTTACAATGCACTTTTTTACGACCAATTAAATGTACATTTTCCT
TTCTTCGCCCGTTGATAAGCGAACGCGATGTGGCGCAGGCAATGTGTTGCTCTTGCGACA
CAAACGCAATCAAAATGGATTCAATTTCGCTTTTTCCCAGTGAAACGAAGAACGAACCGA
CCATCATGATATGCTCCTCTGCATGTTGCGTATTGAATCAATGACAATTTCAATTAAGCC
GCCCGTTCGTCATGCGTTTTCGTGCGCTTCGAAATGCTGATAACGCTGCTGTCCTCCAAC
TGCTTTGCATGTGGACACAATTCCATTTATTTAATTCTTTTATTTGGATCGGTTAAATTA
AAAAGCGCCTTGTTACGCATTTAACGTTGTTTCCGGTGCGTGGTGGTTTCATGCTTCTGG
GAACGGCAAATGGGTTTAGGATTGGGAACCCCTCATCATCTGTTGGAATATACTATTCAA
CCTACAAAAGTAACGTTAAACAACACTACTTTATATTTGATATGAATGGCCACACCTTTT
ATGCCATAAAACATATTGTAAGAGAATACCACTCTTTTTATTCCTTCTTTCCTTCTTGTA
CGTTTTTTGCTGTAAGTAGGTCGTGGTGCTGGTGTTGCAGTTGAAATAACTTAAAATATA
AATCATAAAACTCAAACATAAACTTGACTATTTATTTATTTATTAAGAAAGGAAATATAA
ATTATAAATTACAACAGGTTATGGACCTGCAGCCAAGCTTGGCGCTCGTCCGGGGGCAAT
GAGATATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGT
TCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCT
TCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACA
AAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTG
ACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCA
CGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCA
TGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGC
AAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATG
TGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCG
ATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATT
TCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCG
AGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGT
TGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGAT
CGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGG
TTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGAT
CCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCG
ATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGG
CAAAGGAATAGAGTAGATGCCGACCGAACAAGAGCTGATTTCGAGAACGCCTCAGCCAGC
AACTCGCGCGAGCCTAGCAAGGCAAATGCGAGAGAACGGCCTTACGCTTGGTGGCACAGT
TCTCGTCCACAGTTCGCTAAGCTCGCTCGGCTGGGTCGCGGGAGGGCCGGTCGCAGTGAT
TCAGGCCCTTCTGGATTGTGTTGGTCCCCAGGGCACGATTGTCATGCCCACGCACTCGGG
TGATCTGACTGATCCCGCAGATTGGAGATCGCCGCCCGTGCCTGCCGATTGGGTGCAGAT
CTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGAT
TTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCT
AATTGTTTGTGTATTTTAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGTGGAA
TGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGATGATGAGGC
TACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAA
GGACTTTCCTTCAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAACTCT
TGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGCACTGCTATACAAGAAAATTAT
GGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAACATACTGTT
TTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTCAAAAATTGTG
TACCTTTAGCTTTTTAATTTGTAAAGGGGTTAATAAGGAATATTTGATGTATAGTGCCTT
GACTAGAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACC
TCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGT
TTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAG
CATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATG
TCTGGATCAATTCGTTGCAGGACAGGATGTGGTGCCCGATGTGACTAGCTCTTTGCTGCA
GGCCGTCCTATCCTCTGGTTCCGATAAGAGACCCAGAACTCCGGCCCCCCACCGCCCACC
GCCACCCCCATACATATGTGGTACGCAAGTAAGAGTGCCTGCGCATGCCCCATGTGCCCC
ACCAAGAGCTTTGCATCCCATACAAGTCCCCAAAGTGGAGAACCGAACCAATTCTTCGCG
GGCAGAACAAAAGCTTCTGCACACGTCTCCACTCGAATTTGGAGCCGGCCGGCGTGTGCA
AAAGAGGTGAATCGAACGAAAGACCCGTGTGTAAAGCCGCGTTTCCAAAATGTATAAAAC
CGAGAGCATCTGGCCAATGTGCATCAGTTGTGGTCAGCAGCAAAATCAAGTGAATCATCT
CAGTGCAACTAAAGGGGGGATCTCGAGGGATCCATAACTTCGTATAGCATACATTATACG
AAGTTATAGATCCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATAC
ATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAA
GTGCCACCTGACGTGGATCTCGAGCTCAAGCTTCGAATTCAGGGTTTCCTTGACAATATC
ATACTTATCCTGTCCCTTTTTTTTCCACAGCTACCGGTCGCGACTAGTGACTACAAAGAC
GATGACGACAAGGTCAAACTTTACCCATACGATGTTCCAGATTACGCTGCTGCTTAGACT
AGTTCTAGTCGACCATGAAGATCAAGATCATTGCCCCGCCAGAGCGCAAGTACTCTGTCT
GGATCGGTGGCTCCATCCTGGCTTCGCTGTCCACCTTCCAGCAGATGTGGATCTCCAAGC
AGGAGTACGACGAGTCCGGCCCCTCCATTGTGCACCGCAAGTGCTTCTAAGAAGGATCGC
TTGTCTGGGCAAGAGGATCAGGATCGGGATGGTCTTGATTCTGCTGGAGGAGGAGGAGGA
GAAGTCGAGGAAGCAGCAGCGAAAGTGCAAGTGCGAGTGGTGGAAGTTTGGAGTGCAGCA
CAACAAAATCAACAACAACACCAACTACAAGATGAAAAGAGCGGAACCACCTGCACACCA
TCATCACTATCATCATCGTTTTGGGCGCATGTTGTGTGGTTCCAGCGTATTAATATAATT
AATTTATTCCACATGAGATATGATATGATATACTATGTATTTTTTGTTTTTTTTTTATTT
GTAAACCTTTAATATAACAAGAACTACAAAAAATGAAAATGAGCGAAAATGCATATTCTG
CCATTCCACACACACACCAACAACACCCAACACACGCACACCCACAAGCTTACACACACA
CATTCGCGGCATGACAAGGACATCAAGATAAAGAAGAACTTAAAGAAGATATTTCCCAAA
GCGCAAAAAGAACACACACACATTGCAAAACACAAACAACACACTAGCGTTTTGTACAAT
TCGTCAGCAACCTTATGTATTATTTTTTAATTATGATGTAATTATAAACAAAGTGAAACA
AAAATATGAAAACAAAAAGGAAAATCAAATCTGTCTTCTCTTTCTCCCGCTCTCCTCGCT
CTCTGCTGCTAACCTCGCCCTCTCCTCTCTCATCTTTTTGTCTGTCTCTCTTCCACATTT
TTGCCGGCCGGCAAAATAATAACCCACACACACTCACACTTGGCTGCAGTTTCGCGTGCG
ATATTCACACACATTCAAGCATACAAGCATACATACATATGTATTTTTTTTTTATTTGTA
CACTTTTCTAATTGCATGCGTATCGATTGATAAGTTTACGCCTGAAAATGTTAATTAAAA
TGTGAAAATGCAACTGAAAAACTGATGAAATGAAACAACAACAAGCGAACAATTTGCTAC
ATGTGTATTGTCTAACAACCGTTACTGCAACGGTTGCTTCGGAAAAGGGTGAAGAGGAAG
AGGGCACGAGGTCGACTAGAGCGGCCGCCGACGCGAGGCTGGATGGCCTTCCCCATTATG
ATTCTTCTCGCTTCCGGCGGCATCGGGATG

>pMK33-CHF-BD, 8547 bases.
CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA
GGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCATTGGACCGCTGATCGTCACGGCG
ATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTA
TACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGA
ATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAAT
TCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCG
CCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGC
GCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTT
AGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTG
CGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGC
GGAAGTCAGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGAT
AACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCC
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGA
AGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTT
CTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTG
TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGC
GCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTG
GCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTC
TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTG
CTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACC
GCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCT
CAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGT
TAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAA
AAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAA
TGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCC
TGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCT
GCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCA
GCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT
AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTT
GCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCC
GGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC
TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTT
ATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACT
GGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGC
CCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATT
GGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCG
ATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCT
GGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAA
TGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGT
CTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGC
ACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACC
TATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCACATTTGTACGAATT
TTTTTTTTATCAAAAGTTCGAGTTTTTCACCAATTTCCTCATCAACCGAGCAAGGCAAAC
GGCTTTGAATAATATGGTGTTATATATACATATATCAAATCGCTGCTGACTGCGTGATTG
ATGGCCCCAAGATTACATATTATCGAATCAGGATTCAGAAGGAGATCAATGTCAAATGCG
GACAGGAACATGAAAGACGCCTGTTATGCGCAATTAAAAATTTGGGTTTAATTGCTGTGG
AAACTGTTGTTGGCGGCATCTTAAGTTCCTGTTTAACAACATCAACTACTTATGTACGTA
GAAGCGTTTAAGCCATTTGCATACAGATGAGAACTGGCTTTTGTGCTAATCAGTCAAGAT
GACTCCGATGATGATGACTCATTACCTGACCAGTTTTCGCTGCTTTCTTTTCAACAACTA
CTTGTATATGTATTGTATCCAATAGCAATACATTGAATTTCCATGGTCTAGTCACGTATT
ATCATTTAATTGACACCAAGTCGTGTTATTGTTGAGCTATCGAGTTCAGCTCAAACATTT
CTTATTCCCATGAATAAGCCGGCAAAAATATGCAATCTATGAAAGTTAATATAAGCAAAC
CTTACTTTGACTCAATACCAATGCACTTTGTGTCGATAGGTTCACGCAATTGAGGCGATT
ATTCCGATAACCCAAGCGATTGACTGTTCCCGTTTCGATTCCAATTGAAATTTGGAAATG
TACAATAGTTTTGCTATATGCTGTCAAGTACGCTCTTATCTTCTCTGGGTTTTCTTCAGA
GTTTCGAAACGCTTCTTCTTTTTTTTGTTTTTTTTTTTTTGGAATCTCGTATTTTGGAAG
GGGCTCCCCTCTGGAATTTGTTACACTGTCGTTATCATTGCGAACAAGCGGCCCGAAGCT
ATCAGCGACTTTAACATTTACAATGCACTTTTTTACGACCAATTAAATGTACATTTTCCT
TTCTTCGCCCGTTGATAAGCGAACGCGATGTGGCGCAGGCAATGTGTTGCTCTTGCGACA
CAAACGCAATCAAAATGGATTCAATTTCGCTTTTTCCCAGTGAAACGAAGAACGAACCGA
CCATCATGATATGCTCCTCTGCATGTTGCGTATTGAATCAATGACAATTTCAATTAAGCC
GCCCGTTCGTCATGCGTTTTCGTGCGCTTCGAAATGCTGATAACGCTGCTGTCCTCCAAC
TGCTTTGCATGTGGACACAATTCCATTTATTTAATTCTTTTATTTGGATCGGTTAAATTA
AAAAGCGCCTTGTTACGCATTTAACGTTGTTTCCGGTGCGTGGTGGTTTCATGCTTCTGG
GAACGGCAAATGGGTTTAGGATTGGGAACCCCTCATCATCTGTTGGAATATACTATTCAA
CCTACAAAAGTAACGTTAAACAACACTACTTTATATTTGATATGAATGGCCACACCTTTT
ATGCCATAAAACATATTGTAAGAGAATACCACTCTTTTTATTCCTTCTTTCCTTCTTGTA
CGTTTTTTGCTGTAAGTAGGTCGTGGTGCTGGTGTTGCAGTTGAAATAACTTAAAATATA
AATCATAAAACTCAAACATAAACTTGACTATTTATTTATTTATTAAGAAAGGAAATATAA
ATTATAAATTACAACAGGTTATGGACCTGCAGCCAAGCTTGGCGCTCGTCCGGGGGCAAT
GAGATATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGT
TCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCT
TCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACA
AAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTG
ACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCA
CGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCA
TGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGC
AAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATG
TGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCG
ATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATT
TCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCG
AGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGT
TGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGAT
CGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGG
TTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGAT
CCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCG
ATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGG
CAAAGGAATAGAGTAGATGCCGACCGAACAAGAGCTGATTTCGAGAACGCCTCAGCCAGC
AACTCGCGCGAGCCTAGCAAGGCAAATGCGAGAGAACGGCCTTACGCTTGGTGGCACAGT
TCTCGTCCACAGTTCGCTAAGCTCGCTCGGCTGGGTCGCGGGAGGGCCGGTCGCAGTGAT
TCAGGCCCTTCTGGATTGTGTTGGTCCCCAGGGCACGATTGTCATGCCCACGCACTCGGG
TGATCTGACTGATCCCGCAGATTGGAGATCGCCGCCCGTGCCTGCCGATTGGGTGCAGAT
CTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGAT
TTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCT
AATTGTTTGTGTATTTTAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGTGGAA
TGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGATGATGAGGC
TACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAA
GGACTTTCCTTCAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAACTCT
TGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGCACTGCTATACAAGAAAATTAT
GGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAACATACTGTT
TTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTCAAAAATTGTG
TACCTTTAGCTTTTTAATTTGTAAAGGGGTTAATAAGGAATATTTGATGTATAGTGCCTT
GACTAGAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACC
TCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGT
TTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAG
CATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATG
TCTGGATCAATTCGTTGCAGGACAGGATGTGGTGCCCGATGTGACTAGCTCTTTGCTGCA
GGCCGTCCTATCCTCTGGTTCCGATAAGAGACCCAGAACTCCGGCCCCCCACCGCCCACC
GCCACCCCCATACATATGTGGTACGCAAGTAAGAGTGCCTGCGCATGCCCCATGTGCCCC
ACCAAGAGCTTTGCATCCCATACAAGTCCCCAAAGTGGAGAACCGAACCAATTCTTCGCG
GGCAGAACAAAAGCTTCTGCACACGTCTCCACTCGAATTTGGAGCCGGCCGGCGTGTGCA
AAAGAGGTGAATCGAACGAAAGACCCGTGTGTAAAGCCGCGTTTCCAAAATGTATAAAAC
CGAGAGCATCTGGCCAATGTGCATCAGTTGTGGTCAGCAGCAAAATCAAGTGAATCATCT
CAGTGCAACTAAAGGGGGGATCTCGAGGGATCCATAACTTCGTATAGCATACATTATACG
AAGTTATAGATCCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATAC
ATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAA
GTGCCACCTGACGTGGATCTCGAGCTCAAGCTTCGAATTCAGGGTTTCCTTGACAATATC
ATACTTATCCTGTCCCTTTTTTTTCCACAGCTACCGGTCGCGACTAGTTACCCATACGAT
GTTCCAGATTACGCTGCTAAACTTGACTACAAAGACGATGACGACAAGGTCTAGACTAGT
TCTAGTCGACCATGAAGATCAAGATCATTGCCCCGCCAGAGCGCAAGTACTCTGTCTGGA
TCGGTGGCTCCATCCTGGCTTCGCTGTCCACCTTCCAGCAGATGTGGATCTCCAAGCAGG
AGTACGACGAGTCCGGCCCCTCCATTGTGCACCGCAAGTGCTTCTAAGAAGGATCGCTTG
TCTGGGCAAGAGGATCAGGATCGGGATGGTCTTGATTCTGCTGGAGGAGGAGGAGGAGAA
GTCGAGGAAGCAGCAGCGAAAGTGCAAGTGCGAGTGGTGGAAGTTTGGAGTGCAGCACAA
CAAAATCAACAACAACACCAACTACAAGATGAAAAGAGCGGAACCACCTGCACACCATCA
TCACTATCATCATCGTTTTGGGCGCATGTTGTGTGGTTCCAGCGTATTAATATAATTAAT
TTATTCCACATGAGATATGATATGATATACTATGTATTTTTTGTTTTTTTTTTATTTGTA
AACCTTTAATATAACAAGAACTACAAAAAATGAAAATGAGCGAAAATGCATATTCTGCCA
TTCCACACACACACCAACAACACCCAACACACGCACACCCACAAGCTTACACACACACAT
TCGCGGCATGACAAGGACATCAAGATAAAGAAGAACTTAAAGAAGATATTTCCCAAAGCG
CAAAAAGAACACACACACATTGCAAAACACAAACAACACACTAGCGTTTTGTACAATTCG
TCAGCAACCTTATGTATTATTTTTTAATTATGATGTAATTATAAACAAAGTGAAACAAAA
ATATGAAAACAAAAAGGAAAATCAAATCTGTCTTCTCTTTCTCCCGCTCTCCTCGCTCTC
TGCTGCTAACCTCGCCCTCTCCTCTCTCATCTTTTTGTCTGTCTCTCTTCCACATTTTTG
CCGGCCGGCAAAATAATAACCCACACACACTCACACTTGGCTGCAGTTTCGCGTGCGATA
TTCACACACATTCAAGCATACAAGCATACATACATATGTATTTTTTTTTTATTTGTACAC
TTTTCTAATTGCATGCGTATCGATTGATAAGTTTACGCCTGAAAATGTTAATTAAAATGT
GAAAATGCAACTGAAAAACTGATGAAATGAAACAACAACAAGCGAACAATTTGCTACATG
TGTATTGTCTAACAACCGTTACTGCAACGGTTGCTTCGGAAAAGGGTGAAGAGGAAGAGG
GCACGAGGTCGACTAGAGCGGCCGCCGACGCGAGGCTGGATGGCCTTCCCCATTATGATT
CTTCTCGCTTCCGGCGGCATCGGGATG

>pUAST-NTAP-BD, 9759 bases.
GGCCAGACCCACGTAGTCCAGCGGCAGATCGGCGGCGGAGAAGTTAAGCGTCTCCAGGAT
GACCTTGCCCGAACTGGGGCACGTGGTGTTCGACGATGTGCAGCTAATTTCGCCCGGCTC
CACGTCCGCCCATTGGTTAATCAGCAGACCCTCGTTGGCGTAACGGAACCATGAGAGGTA
CGACAACCATTTGAGGTATACTGGCACCGAGCCCGAGTTCAAGAAGAAGGCGTTTTTCCA
TAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAA
CCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCC
TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC
GCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCT
GGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCG
TCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAG
GATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTA
CGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGG
AAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTT
TGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTT
TTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAG
ATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAAT
CTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACC
TATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGAT
AACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCC
ACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAG
AAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAG
AGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGT
GGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCG
AGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGT
TGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTC
TCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTC
ATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAA
TACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCG
AAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACC
CAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAG
GCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTT
CCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATT
TGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCC
ACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCAC
GAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCT
CCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGG
CGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGAT
TGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACCGAATCGCGCGGAACTAACG
ACAGTCGCTCCAAGGTCGTCGAACAAAAGGTGAATGTGTTGCGGAGAGCGGGTGGGAGAC
AGCGAAAGAGCAACTACGAAACGTGGTGTGGTGGAGGTGAATTATGAAGAGGGCGCGCGA
TTTGAAAAGTATGTATATAAAAAATATATCCCGGTGTTTTATGTAGCGATAAACGAGTTT
TTGATGTAAGGTATGCAGGTGTGTAAGTCTTTTGGTTAGAAGACAAATCCAAAGTCTACT
TGTGGGGATGTTCGAAGGGGAAATACTTGTATTCTATAGGTCATATCTTGTTTTTATTGG
CACAAATATAATTACATTAGCTTTTTGAGGGGGCAATAAACAGTAAACACGATGGTAATA
ATGGTAAAAAAAAAAACAAGCAGTTATTTCGGATATATGTCGGCTACTCCTTGCGTCGGG
CCCGAAGTCTTAGAGCCAGATATGCGAGCACCCGGAAGCTCACGATGAGAATGGCCAGAC
CATGATGAAATAACATAAGGTGGTCCCGTCGGCAAGAGACATCCACTTAACGTATGCTTG
CAATAAGTGCGAGTGAAAGGAATAGTATTCTGAGTGTCGTATTGAGTCTGAGTGAGACAG
CGATATGATTGTTGATTAACCCTTAGCATGTCCGTGGGGTTTGAATTAACTCATAATATT
AATTAGACGAAATTATTTTTAAAGTTTTATTTTTAATAATTTGCGAGTACGCAAAGCTTG
GCTGCATCCAACGCGTTGGGAGCTCTCCGGATCCAAGCTTGCATGCCTGCAGGTCGGAGT
ACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACT
GTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGACTCTAGCGAGCGCCGGAGTATAAAT
AGAGGCGCTTCGTCTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCT
AAGCGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCTGCAGTAAAG
TGCAAGTTAAAGTGAATCAATTAAAAGTAACCAGCAACCAAGTAAATCAACTGCAACTAC
TGAAATCTGCCAAGAAGTAATTATTGAATACAAGAAGAGAACTCTGAATAGGGAATTGGG
AATTGACACCATGGCAGGCCTTGCGCAACACGATGAAGCCGTGGACAACAAATTCAACAA
AGAACAACAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTAAACGAAGAACAACG
AAACGCCTTCATCCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGA
AGCTAAAAAGCTAAATGATGCTCAGGCGCCGAAAGTAGACAACAAATTCAACAAAGAACA
ACAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTAAACGAAGAACAACGAAACGC
CTTCATCCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAA
AAAGCTAAATGATGCTCAGGCGCCGAAAGTAGACGCGAATTGTGATATACCTACAACTGC
TTCTGAAAATTTATATTTTCAAGGTGAACTAAAGAGAAGATGGAAAAAGAATTTCATAGC
CGTCTCAGCAGCCAACCGCTTTAAGAAAATCTCATCCTCCGGGGCACTTGATGATGACGA
TAAGCTTATCGGGAATTCATAACTTCGTATAGCATACATTATACGAAGTTATAGATCCAA
TATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATT
TAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC
TCGAGGGTACCTCTAGAGGATCTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATT
GGACAAACTACCTACAGAGATTTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATA
ATGTGTTAAACTACTGATTCTAATTGTTTGTGTATTTTAGATTCCAACCTATGGAACTGA
TGAATGGGAGCAGTGGTGGAATGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAAT
GCCATCTAGTGATGATGAGGCTACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAA
GAGAAAGGTAGAAGACCCCAAGGACTTTCCTTCAGAATTGCTAAGTTTTTTGAGTCATGC
TGTGTTTAGTAATAGAACTCTTGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGC
ACTGCTATACAAGAAAATTATGGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAG
TTATAATCATAACATACTGTTTTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAA
TAACTATGCTCAAAAATTGTGTACCTTTAGCTTTTTAATTTGTAAAGGGGTTAATAAGGA
ATATTTGATGTATAGTGCCTTGACTAGAGATCATAATCAGCCATACCACATTTGTAGAGG
TTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATG
CAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCA
TCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAAC
TCATCAATGTATCTTATCATGTCTGGATCGGATCCACTAGAAGGCCTTAGTATGTATGTA
AGTTAATAAAACCCTTTTTTGGAGAATGTAGATTTAAAAAAACATATTTTTTTTTTATTT
TTTACTGCACTGGACATCATTGAACTTATCTGATCAGTTTTAAATTTACTTCGATCCAAG
GGTATTTGAAGTACCAGGTTCTTTCGATTACCTCTCACTCAAAATGACATTCCACTCAAA
GTCAGCGCTGTTTGCCTCCTTCTCTGTCCACAGAAATATCGCCGTCTCTTTCGCCGCTGC
GTCCGCTATCTCTTTCGCCACCGTTTGTAGCGTTACCTAGCGTCAATGTCCGCCTTCAGT
TGCACTTTGTCAGCGGTTTCGTGACGAAGCTCCAAGCGGTTTACGCCATCAATTAAACAC
AAAGTGCTGTGCCAAAACTCCTCTCGCTTCTTATTTTTGTTTGTTTTTTGAGTGATTGGG
GTGGTGATTGGTTTTGGGTGGGTAAGCAGGGGAAAGTGTGAAAAATCCCGGCAATGGGCC
AAGAGGATCAGGAGCTATTAATTCGCGGAGGCAGCAAACACCCATCTGCCGAGCATCTGA
ACAATGTGAGTAGTACATGTGCATACATCTTAAGTTCACTTGATCTATAGGAACTGCGAT
TGCAACATCAAATTGTCTGCGGCGTGAGAACTGCGACCCACAAAAATCCCAAACCGCAAT
CGCACAAACAAATAGTGACACGAAACAGATTATTCTGGTAGCTGTGCTCGCTATATAAGA
CAATTTTTAAGATCATATCATGATCAAGACATCTAAAGGCATTCATTTTCGACTACATTC
TTTTTTACAAAAAATATAACAACCAGATATTTTAAGCTGATCCTAGATGCACAAAAAATA
AATAAAAGTATAAACCTACTTCGTAGGATACTTCGTTTTGTTCGGGGTTAGATGAGCATA
ACGCTTGTAGTTGATATTTGAGATCCCCTATCATTGCAGGGTGACAGCGGAGCGGCTTCG
CAGAGCTGCATTAACCAGGGCTTCGGGCAGGCCAAAAACTACGGCACGCTCCTGCCACCC
AGTCCGCCGGAGGACTCCGGTTCAGGGAGCGGCCAACTAGCCGAGAACCTCACCTATGCC
TGGCACAATATGGACATCTTTGGGGCGGTCAATCAGCCGGGCTCCGGATGGCGGCAGCTG
GTCAACCGGACACGCGGACTATTCTGCAACGAGCGACACATACCGGCGCCCAGGAAACAT
TTGCTCAAGAACGGTGAGTTTCTATTCGCAGTCGGCTGATCTGTGTGAAATCTTAATAAA
GGGTCCAATTACCAATTTGAAACTCAGTTTGCGGCGTGGCCTATCCGGGCGAACTTTTGG
CCGTGATGGGCAGTTCCGGTGCCGGAAAGACGACCCTGCTGAATGCCCTTGCCTTTCGAT
CGCCGCAGGGCATCCAAGTATCGCCATCCGGGATGCGACTGCTCAATGGCCAACCTGTGG
ACGCCAAGGAGATGCAGGCCAGGTGCGCCTATGTCCAGCAGGATGACCTCTTTATCGGCT
CCCTAACGGCCAGGGAACACCTGATTTTCCAGGCCATGGTGCGGATGCCACGACATCTGA
CCTATCGGCAGCGAGTGGCCCGCGTGGATCAGGTGATCCAGGAGCTTTCGCTCAGCAAAT
GTCAGCACACGATCATCGGTGTGCCCGGCAGGGTGAAAGGTCTGTCCGGCGGAGAAAGGA
AGCGTCTGGCATTCGCCTCCGAGGCACTAACCGATCCGCCGCTTCTGATCTGCGATGAGC
CCACCTCCGGACTGGACTCATTTACCGCCCACAGCGTCGTCCAGGTGCTGAAGAAGCTGT
CGCAGAAGGGCAAGACCGTCATCCTGACCATTCATCAGCCGTCTTCCGAGCTGTTTGAGC
TCTTTGACAAGATCCTTCTGATGGCCGAGGGCAGGGTAGCTTTCTTGGGCACTCCCAGCG
AAGCCGTCGACTTCTTTTCCTAGTGAGTTCGATGTGTTTATTAAGGGTATCTAGCATTAC
ATTACATCTCAACTCCTATCCAGCGTGGGTGCCCAGTGTCCTACCAACTACAATCCGGCG
GACTTTTACGTACAGGTGTTGGCCGTTGTGCCCGGACGGGAGATCGAGTCCCGTGATCGG
ATCGCCAAGATATGCGACAATTTTGCTATTAGCAAAGTAGCCCGGGATATGGAGCAGTTG
TTGGCCACCAAAAATTTGGAGAAGCCACTGGAGCAGCCGGAGAATGGGTACACCTACAAG
GCCACCTGGTTCATGCAGTTCCGGGCGGTCCTGTGGCGATCCTGGCTGTCGGTGCTCAAG
GAACCACTCCTCGTAAAAGTGCGACTTATTCAGACAACGGTGAGTGGTTCCAGTGGAAAC
AAATGATATAACGCTTACAATTCTTGGAAACAAATTCGCTAGATTTTAGTTAGAATTGCC
TGATTCCACACCCTTCTTAGTTTTTTTCAATGAGATGTATAGTTTATAGTTTTGCAGAAA
ATAAATAAATTTCATTTAACTCGCGAACATGTTGAAGATATGAATATTAATGAGATGCGA
GTAACATTTTAATTTGCAGATGGTTGCCATCTTGATTGGCCTCATCTTTTTGGGCCAACA
ACTCACGCAAGTGGGCGTGATGAATATCAACGGAGCCATCTTCCTCTTCCTGACCAACAT
GACCTTTCAAAACGTCTTTGCCACGATAAATGTAAGTCTTGTTTAGAATACATTTGCATA
TTAATAATTTACTAACTTTCTAATGAATCGATTCGATTTAGGTGTTCACCTCAGAGCTGC
CAGTTTTTATGAGGGAGGCCCGAAGTCGACTTTATCGCTGTGACACATACTTTCTGGGCA
AAACGATTGCCGAATTACCGCTTTTTCTCACAGTGCCACTGGTCTTCACGGCGATTGCCT
ATCCGATGATCGGACTGCGGGCCGGAGTGCTGCACTTCTTCAACTGCCTGGCGCTGGTCA
CTCTGGTGGCCAATGTGTCAACGTCCTTCGGATATCTAATATCCTGCGCCAGCTCCTCGA
CCTCGATGGCGCTGTCTGTGGGTCCGCCGGTTATCATACCATTCCTGCTCTTTGGCGGCT
TCTTCTTGAACTCGGGCTCGGTGCCAGTATACCTCAAATGGTTGTCGTACCTCTCATGGT
TCCGTTACGCCAACGAGGGTCTGCTGATTAACCAATGGGCGGACGTGGAGCCGGGCGAAA
TTAGCTGCACATCGTCGAACACCACGTGCCCCAGTTCGGGCAAGGTCATCCTGGAGACGC
TTAACTTCTCCGCCGCCGATCTGCCGCTGGACTACGTGGGTCTGGCCATTCTCATCGTGA
GCTTCCGGGTGCTCGCATATCTGGCTCTAAGACTTCGGGCCCGACGCAAGGAGTAGCCGA
CATATATCCGAAATAACTGCTTGTTTTTTTTTTTACCATTATTACCATCGTGTTTACTGT
TTATTGCCCCCTCAAAAAGCTAATGTAATTATATTTGTGCCAATAAAAACAAGATATGAC
CTATAGAATACAAGTATTTCCCCTTCGAACATCCCCACAAGTAGACTTTGGATTTGTCTT
CTAACCAAAAGACTTACACACCTGCATACCTTACATCAAAAACTCGTTTATCGCTACATA
AAACACCGGGATATATTTTTTATATACATACTTTTCAAATCGCGCGCCCTCTTCATAATT
CACCTCCACCACACCACGTTTCGTAGTTGCTCTTTCGCTGTCTCCCACCCGCTCTCCGCA
ACACATTCACCTTTTGTTCGACGACCTTGGAGCGACTGTCGTTAGTTCCGCGCGATTCGG
TTCGCTCAAATGGTTCCGAGTGGTTCATTTCGTCTCAATAGAAATTAGTAATAAATATTT
GTATGTACAATTTATTTGCTCCAATATATTTGTATATATTTCCCTCACAGCTATATTTAT
TCTAATTTAATATTATGACTTTTTAAGGTAATTTTTTGTGACCTGTTCGGAGTGATTAGC
GTTACAATTTGAACTGAAAGTGACATCCAGTGTTTGTTCCTTGTGTAGATGCATCTCAAA
AAAATGGTGGGCATAATAGTGTTGTTTATATATATCAAAAATAACAACTATAATAATAAG
AATACATTTAATTTAGAAAATGCTTGGATTTCACTGGAACTAGAATTAATTCGGCTGCTG
CTCTAAACGACGCATTTCGTACTCCAAAGTACGAATTTTTTCCCTCAAGCTCTTATTTTC
ATTAAACAATGAACAGGACCTAACGCACAGTCACGTTATTGTTTACATAAATGATTTTTT
TTACTATTCAAACTTACTCTGTTTGTGTACTCCCACTGGTATAGCCTTCTTTTATCTTTT
CTGGTTCAGGCTCTATCACTTTACTAGGTACGGCATCTGCGTTGAGTCGCCTCCTTTTAA
ATGTCTGACCTTTTGCAGGTGCAGCCTTCCACTGCGAATCATTAAAGTGGGTATCACAAA
TTTGGGAGTTTTCACCAAGGCTGCACCCAAGGCTCTGCTCCCACAATTTTCTCTTAATAG
CACACTTCGGCACGTGAATTAATTTTACTCCAGTCACAGCTTTGCAGCAAAATTTGCAAT
ATTTCATTTTTTTTTATTCCACGTAAGGGTTAATGTTTTCAAAAAAAAATTCGTCCGCAC
ACAACCTTTCCTCTCAACAAGCAAACGTGCACTGAATTTAAGTGTATACTTCGGTAAGCT
TCGGCTATCGACGGGACCACCTTATGTTATTTCATCATG

>pUAST-CTAP-BD, 9862 bases.
GGCCAGACCCACGTAGTCCAGCGGCAGATCGGCGGCGGAGAAGTTAAGCGTCTCCAGGAT
GACCTTGCCCGAACTGGGGCACGTGGTGTTCGACGATGTGCAGCTAATTTCGCCCGGCTC
CACGTCCGCCCATTGGTTAATCAGCAGACCCTCGTTGGCGTAACGGAACCATGAGAGGTA
CGACAACCATTTGAGGTATACTGGCACCGAGCCCGAGTTCAAGAAGAAGGCGTTTTTCCA
TAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAA
CCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCC
TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC
GCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCT
GGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCG
TCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAG
GATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTA
CGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGG
AAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTT
TGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTT
TTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAG
ATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAAT
CTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACC
TATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGAT
AACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCC
ACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAG
AAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAG
AGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGT
GGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCG
AGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGT
TGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTC
TCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTC
ATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAA
TACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCG
AAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACC
CAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAG
GCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTT
CCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATT
TGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCC
ACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCAC
GAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCT
CCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGG
CGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGAT
TGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACCGAATCGCGCGGAACTAACG
ACAGTCGCTCCAAGGTCGTCGAACAAAAGGTGAATGTGTTGCGGAGAGCGGGTGGGAGAC
AGCGAAAGAGCAACTACGAAACGTGGTGTGGTGGAGGTGAATTATGAAGAGGGCGCGCGA
TTTGAAAAGTATGTATATAAAAAATATATCCCGGTGTTTTATGTAGCGATAAACGAGTTT
TTGATGTAAGGTATGCAGGTGTGTAAGTCTTTTGGTTAGAAGACAAATCCAAAGTCTACT
TGTGGGGATGTTCGAAGGGGAAATACTTGTATTCTATAGGTCATATCTTGTTTTTATTGG
CACAAATATAATTACATTAGCTTTTTGAGGGGGCAATAAACAGTAAACACGATGGTAATA
ATGGTAAAAAAAAAAACAAGCAGTTATTTCGGATATATGTCGGCTACTCCTTGCGTCGGG
CCCGAAGTCTTAGAGCCAGATATGCGAGCACCCGGAAGCTCACGATGAGAATGGCCAGAC
CATGATGAAATAACATAAGGTGGTCCCGTCGGCAAGAGACATCCACTTAACGTATGCTTG
CAATAAGTGCGAGTGAAAGGAATAGTATTCTGAGTGTCGTATTGAGTCTGAGTGAGACAG
CGATATGATTGTTGATTAACCCTTAGCATGTCCGTGGGGTTTGAATTAACTCATAATATT
AATTAGACGAAATTATTTTTAAAGTTTTATTTTTAATAATTTGCGAGTACGCAAAGCTTG
GCTGCATCCAACGCGTTGGGAGCTCTCCGGATCCAAGCTTGCATGCCTGCAGGTCGGAGT
ACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACT
GTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGACTCTAGCGAGCGCCGGAGTATAAAT
AGAGGCGCTTCGTCTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCT
AAGCGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCTGCAGTAAAG
TGCAAGTTAAAGTGAATCAATTAAAAGTAACCAGCAACCAAGTAAATCAACTGCAACTAC
TGAAATCTGCCAAGAAGTAATTATTGAATACAAGAAGAGAACTCTGAATAGGGAATTGGG
AATTCGTTAACAGATCTGCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATA
GATCCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGA
ATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACC
TGACGTGGATCTCGAGCTCAAGCTTCGAATTCAGGGTTTCCTTGACAATATCATACTTAT
CCTGTCCCTTTTTTTTCCACAGCTACCGGTCGCGTCTAGATCCATGGAAAAGAGAAGATG
GAAAAAGAATTTCATAGCCGTCTCAGCAGCCAACCGCTTTAAGAAAATCTCATCCTCCGG
GGCACTTGATTATGATATTCCAACTACTGCTAGCGAGAATTTGTATTTTCAGGGTGAGCT
CAAAACCGCGGCTCTTGCGCAACACGATGAAGCCGTGGACAACAAATTCAACAAAGAACA
ACAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTAAACGAAGAACAACGAAACGC
CTTCATCCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAA
AAAGCTAAATGATGCTCAGGCGCCGAAAGTAGACAACAAATTCAACAAAGAACAACAAAA
CGCGTTCTATGAGATCTTACATTTACCTAACTTAAACGAAGAACAACGAAACGCCTTCAT
CCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAAAAAGCT
AAATGGTGCTCAGGCGCCGAAAGTAGACGCGAACTCCGCGGGGAAGTCAACCTGACTAGA
GGATCTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAG
AGATTTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGA
TTCTAATTGTTTGTGTATTTTAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGT
GGAATGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGATGATG
AGGCTACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACC
CCAAGGACTTTCCTTCAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAA
CTCTTGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGCACTGCTATACAAGAAAA
TTATGGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAACATAC
TGTTTTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTCAAAAAT
TGTGTACCTTTAGCTTTTTAATTTGTAAAGGGGTTAATAAGGAATATTTGATGTATAGTG
CCTTGACTAGAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAA
AACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAAC
TTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAAT
AAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTAT
CATGTCTGGATCGGATCCACTAGAAGGCCTTAGTATGTATGTAAGTTAATAAAACCCTTT
TTTGGAGAATGTAGATTTAAAAAAACATATTTTTTTTTTATTTTTTACTGCACTGGACAT
CATTGAACTTATCTGATCAGTTTTAAATTTACTTCGATCCAAGGGTATTTGAAGTACCAG
GTTCTTTCGATTACCTCTCACTCAAAATGACATTCCACTCAAAGTCAGCGCTGTTTGCCT
CCTTCTCTGTCCACAGAAATATCGCCGTCTCTTTCGCCGCTGCGTCCGCTATCTCTTTCG
CCACCGTTTGTAGCGTTACCTAGCGTCAATGTCCGCCTTCAGTTGCACTTTGTCAGCGGT
TTCGTGACGAAGCTCCAAGCGGTTTACGCCATCAATTAAACACAAAGTGCTGTGCCAAAA
CTCCTCTCGCTTCTTATTTTTGTTTGTTTTTTGAGTGATTGGGGTGGTGATTGGTTTTGG
GTGGGTAAGCAGGGGAAAGTGTGAAAAATCCCGGCAATGGGCCAAGAGGATCAGGAGCTA
TTAATTCGCGGAGGCAGCAAACACCCATCTGCCGAGCATCTGAACAATGTGAGTAGTACA
TGTGCATACATCTTAAGTTCACTTGATCTATAGGAACTGCGATTGCAACATCAAATTGTC
TGCGGCGTGAGAACTGCGACCCACAAAAATCCCAAACCGCAATCGCACAAACAAATAGTG
ACACGAAACAGATTATTCTGGTAGCTGTGCTCGCTATATAAGACAATTTTTAAGATCATA
TCATGATCAAGACATCTAAAGGCATTCATTTTCGACTACATTCTTTTTTACAAAAAATAT
AACAACCAGATATTTTAAGCTGATCCTAGATGCACAAAAAATAAATAAAAGTATAAACCT
ACTTCGTAGGATACTTCGTTTTGTTCGGGGTTAGATGAGCATAACGCTTGTAGTTGATAT
TTGAGATCCCCTATCATTGCAGGGTGACAGCGGAGCGGCTTCGCAGAGCTGCATTAACCA
GGGCTTCGGGCAGGCCAAAAACTACGGCACGCTCCTGCCACCCAGTCCGCCGGAGGACTC
CGGTTCAGGGAGCGGCCAACTAGCCGAGAACCTCACCTATGCCTGGCACAATATGGACAT
CTTTGGGGCGGTCAATCAGCCGGGCTCCGGATGGCGGCAGCTGGTCAACCGGACACGCGG
ACTATTCTGCAACGAGCGACACATACCGGCGCCCAGGAAACATTTGCTCAAGAACGGTGA
GTTTCTATTCGCAGTCGGCTGATCTGTGTGAAATCTTAATAAAGGGTCCAATTACCAATT
TGAAACTCAGTTTGCGGCGTGGCCTATCCGGGCGAACTTTTGGCCGTGATGGGCAGTTCC
GGTGCCGGAAAGACGACCCTGCTGAATGCCCTTGCCTTTCGATCGCCGCAGGGCATCCAA
GTATCGCCATCCGGGATGCGACTGCTCAATGGCCAACCTGTGGACGCCAAGGAGATGCAG
GCCAGGTGCGCCTATGTCCAGCAGGATGACCTCTTTATCGGCTCCCTAACGGCCAGGGAA
CACCTGATTTTCCAGGCCATGGTGCGGATGCCACGACATCTGACCTATCGGCAGCGAGTG
GCCCGCGTGGATCAGGTGATCCAGGAGCTTTCGCTCAGCAAATGTCAGCACACGATCATC
GGTGTGCCCGGCAGGGTGAAAGGTCTGTCCGGCGGAGAAAGGAAGCGTCTGGCATTCGCC
TCCGAGGCACTAACCGATCCGCCGCTTCTGATCTGCGATGAGCCCACCTCCGGACTGGAC
TCATTTACCGCCCACAGCGTCGTCCAGGTGCTGAAGAAGCTGTCGCAGAAGGGCAAGACC
GTCATCCTGACCATTCATCAGCCGTCTTCCGAGCTGTTTGAGCTCTTTGACAAGATCCTT
CTGATGGCCGAGGGCAGGGTAGCTTTCTTGGGCACTCCCAGCGAAGCCGTCGACTTCTTT
TCCTAGTGAGTTCGATGTGTTTATTAAGGGTATCTAGCATTACATTACATCTCAACTCCT
ATCCAGCGTGGGTGCCCAGTGTCCTACCAACTACAATCCGGCGGACTTTTACGTACAGGT
GTTGGCCGTTGTGCCCGGACGGGAGATCGAGTCCCGTGATCGGATCGCCAAGATATGCGA
CAATTTTGCTATTAGCAAAGTAGCCCGGGATATGGAGCAGTTGTTGGCCACCAAAAATTT
GGAGAAGCCACTGGAGCAGCCGGAGAATGGGTACACCTACAAGGCCACCTGGTTCATGCA
GTTCCGGGCGGTCCTGTGGCGATCCTGGCTGTCGGTGCTCAAGGAACCACTCCTCGTAAA
AGTGCGACTTATTCAGACAACGGTGAGTGGTTCCAGTGGAAACAAATGATATAACGCTTA
CAATTCTTGGAAACAAATTCGCTAGATTTTAGTTAGAATTGCCTGATTCCACACCCTTCT
TAGTTTTTTTCAATGAGATGTATAGTTTATAGTTTTGCAGAAAATAAATAAATTTCATTT
AACTCGCGAACATGTTGAAGATATGAATATTAATGAGATGCGAGTAACATTTTAATTTGC
AGATGGTTGCCATCTTGATTGGCCTCATCTTTTTGGGCCAACAACTCACGCAAGTGGGCG
TGATGAATATCAACGGAGCCATCTTCCTCTTCCTGACCAACATGACCTTTCAAAACGTCT
TTGCCACGATAAATGTAAGTCTTGTTTAGAATACATTTGCATATTAATAATTTACTAACT
TTCTAATGAATCGATTCGATTTAGGTGTTCACCTCAGAGCTGCCAGTTTTTATGAGGGAG
GCCCGAAGTCGACTTTATCGCTGTGACACATACTTTCTGGGCAAAACGATTGCCGAATTA
CCGCTTTTTCTCACAGTGCCACTGGTCTTCACGGCGATTGCCTATCCGATGATCGGACTG
CGGGCCGGAGTGCTGCACTTCTTCAACTGCCTGGCGCTGGTCACTCTGGTGGCCAATGTG
TCAACGTCCTTCGGATATCTAATATCCTGCGCCAGCTCCTCGACCTCGATGGCGCTGTCT
GTGGGTCCGCCGGTTATCATACCATTCCTGCTCTTTGGCGGCTTCTTCTTGAACTCGGGC
TCGGTGCCAGTATACCTCAAATGGTTGTCGTACCTCTCATGGTTCCGTTACGCCAACGAG
GGTCTGCTGATTAACCAATGGGCGGACGTGGAGCCGGGCGAAATTAGCTGCACATCGTCG
AACACCACGTGCCCCAGTTCGGGCAAGGTCATCCTGGAGACGCTTAACTTCTCCGCCGCC
GATCTGCCGCTGGACTACGTGGGTCTGGCCATTCTCATCGTGAGCTTCCGGGTGCTCGCA
TATCTGGCTCTAAGACTTCGGGCCCGACGCAAGGAGTAGCCGACATATATCCGAAATAAC
TGCTTGTTTTTTTTTTTACCATTATTACCATCGTGTTTACTGTTTATTGCCCCCTCAAAA
AGCTAATGTAATTATATTTGTGCCAATAAAAACAAGATATGACCTATAGAATACAAGTAT
TTCCCCTTCGAACATCCCCACAAGTAGACTTTGGATTTGTCTTCTAACCAAAAGACTTAC
ACACCTGCATACCTTACATCAAAAACTCGTTTATCGCTACATAAAACACCGGGATATATT
TTTTATATACATACTTTTCAAATCGCGCGCCCTCTTCATAATTCACCTCCACCACACCAC
GTTTCGTAGTTGCTCTTTCGCTGTCTCCCACCCGCTCTCCGCAACACATTCACCTTTTGT
TCGACGACCTTGGAGCGACTGTCGTTAGTTCCGCGCGATTCGGTTCGCTCAAATGGTTCC
GAGTGGTTCATTTCGTCTCAATAGAAATTAGTAATAAATATTTGTATGTACAATTTATTT
GCTCCAATATATTTGTATATATTTCCCTCACAGCTATATTTATTCTAATTTAATATTATG
ACTTTTTAAGGTAATTTTTTGTGACCTGTTCGGAGTGATTAGCGTTACAATTTGAACTGA
AAGTGACATCCAGTGTTTGTTCCTTGTGTAGATGCATCTCAAAAAAATGGTGGGCATAAT
AGTGTTGTTTATATATATCAAAAATAACAACTATAATAATAAGAATACATTTAATTTAGA
AAATGCTTGGATTTCACTGGAACTAGAATTAATTCGGCTGCTGCTCTAAACGACGCATTT
CGTACTCCAAAGTACGAATTTTTTCCCTCAAGCTCTTATTTTCATTAAACAATGAACAGG
ACCTAACGCACAGTCACGTTATTGTTTACATAAATGATTTTTTTTACTATTCAAACTTAC
TCTGTTTGTGTACTCCCACTGGTATAGCCTTCTTTTATCTTTTCTGGTTCAGGCTCTATC
ACTTTACTAGGTACGGCATCTGCGTTGAGTCGCCTCCTTTTAAATGTCTGACCTTTTGCA
GGTGCAGCCTTCCACTGCGAATCATTAAAGTGGGTATCACAAATTTGGGAGTTTTCACCA
AGGCTGCACCCAAGGCTCTGCTCCCACAATTTTCTCTTAATAGCACACTTCGGCACGTGA
ATTAATTTTACTCCAGTCACAGCTTTGCAGCAAAATTTGCAATATTTCATTTTTTTTTAT
TCCACGTAAGGGTTAATGTTTTCAAAAAAAAATTCGTCCGCACACAACCTTTCCTCTCAA
CAAGCAAACGTGCACTGAATTTAAGTGTATACTTCGGTAAGCTTCGGCTATCGACGGGAC
CACCTTATGTTATTTCATCATG

>pUAST-CTAP-BDattB, 8686 bases.
TAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTT
CGTCTTCAAGAATTCGTTTAAACGGCCGGCCAGATCTGGTACCGGATCCAAGCTTGCATG
CCTGCAGGTCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCC
TCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGACTCTAGCGAG
CGCCGGAGTATAAATAGAGGCGCTTCGTCTACGGAGCGACAATTCAATTCAAACAAGCAA
AGTGAACACGTCGCTAAGCGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAA
CAATCTGCAGTAAAGTGCAAGTTAAAGTGAATCAATTAAAAGTAACCAGCAACCAAGTAA
ATCAACTGCAACTACTGAAATCTGCCAAGAAGTAATTATTGAATACAAGAAGAGAACTCT
GAATAGGGAATTGGGAATTCGTTAACAGATCTGCGGCCGCATAACTTCGTATAGCATACA
TTATACGAAGTTATAGATCCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAG
CGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCC
CCGAAAAGTGCCACCTGACGTGGATCTCGAGCTCAAGCTTCGAATTCAGGGTTTCCTTGA
CAATATCATACTTATCCTGTCCCTTTTTTTTCCACAGCTACCGGTCGCGTCTAGATCCAT
GGAAAAGAGAAGATGGAAAAAGAATTTCATAGCCGTCTCAGCAGCCAACCGCTTTAAGAA
AATCTCATCCTCCGGGGCACTTGATTATGATATTCCAACTACTGCTAGCGAGAATTTGTA
TTTTCAGGGTGAGCTCAAAACCGCGGCTCTTGCGCAACACGATGAAGCCGTGGACAACAA
ATTCAACAAAGAACAACAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTAAACGA
AGAACAACGAAACGCCTTCATCCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCT
TTTAGCAGAAGCTAAAAAGCTAAATGATGCTCAGGCGCCGAAAGTAGACAACAAATTCAA
CAAAGAACAACAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTAAACGAAGAACA
ACGAAACGCCTTCATCCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGC
AGAAGCTAAAAAGCTAAATGGTGCTCAGGCGCCGAAAGTAGACGCGAACTCCGCGGGGAA
GTCAACCTGACTAGAGGATCTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGG
ACAAACTACCTACAGAGATTTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAAT
GTGTTAAACTACTGATTCTAATTGTTTGTGTATTTTAGATTCCAACCTATGGAACTGATG
AATGGGAGCAGTGGTGGAATGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGC
CATCTAGTGATGATGAGGCTACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGA
GAAAGGTAGAAGACCCCAAGGACTTTCCTTCAGAATTGCTAAGTTTTTTGAGTCATGCTG
TGTTTAGTAATAGAACTCTTGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGCAC
TGCTATACAAGAAAATTATGGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTT
ATAATCATAACATACTGTTTTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATA
ACTATGCTCAAAAATTGTGTACCTTTAGCTTTTTAATTTGTAAAGGGGTTAATAAGGAAT
ATTTGATGTATAGTGCCTTGACTAGAGATCATAATCAGCCATACCACATTTGTAGAGGTT
TTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCA
ATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC
ACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTC
ATCAATGTATCTTATCATGTCTGGATCGGATCCCCGCGCGGCCGCTGGCCACGGGTGCGC
ATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAG
CAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCG
ACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGG
AAGTCAGCGCCCTGCACCATTATGTTCCGGAGGCGCGCCCTAGTTCCAGTGAAATCCAAG
CATTTTCTAAATTAAATGTATTCTTATTATTATAGTTGTTATTTTTGATATATATAAACA
ACACTATTATGCCCACCATTTTTTTGAGATGCATCTACACAAGGAACAAACACTGGATGT
CACTTTCAGTTCAAATTGTAACGCTAATCACTCCGAACAGGTCACAAAAAATTACCTTAA
AAAGTCATAATATTAAATTAGAATAAATATAGCTGTGAGGGAAATATATACAAATATATT
GGAGCAAATAAATTGTACATACAAATATTTATTACTAATTTCTATTGAGACGAAATGAAC
CACTCGGAACCATTTGAGCGAACCGAATCGCGCGGAACTAACGACAGTCGCTCCAAGGTC
GTCGAACAAAAGGTGAATGTGTTGCGGAGAGCGGGTGGGAGACAGCGAAAGAGCAACTAC
GAAACGTGGTGTGGTGGAGGTGAATTATGAAGAGGGCGCGCGATTTGAAAAGTATGTATA
TAAAAAATATATCCCGGTGTTTTATGTAGCGATAAACGAGTTTTTGATGTAAGGTATGCA
GGTGTGTAAGTCTTTTGGTTAGAAGACAAATCCAAAGTCTACTTGTGGGGATGTTCGAAG
GGGAAATACTTGTATTCTATAGGTCATATCTTGTTTTTATTGGCACAAATATAATTACAT
TAGCTTTTTGAGGGGGCAATAAACAGTAAACACGATGGTAATAATGGTAAAAAAAAAAAA
CAAGCAGTTATTTCGGATATATGTCGGCTACTCCTTGCGTCGGGCCCGAAGTCTTAGAGC
CAGATATGCGAGCACCCGGAAGCTCACGATGAGAATGGCCAGACCCACGTAGTCCAGCGG
CAGATCGGCGGCGGAGAAGTTAAGCGTCTCCAGGATGACCTTGCCCGAACTGGGGCACGT
GGTGTTCGACGATGTGCAGCTAATTTCGCCCGGCTCCACGTCCGCCCATTGGTTAATCAG
CAGACCCTCGTTGGCGTAACGGAACCATGAGAGGTACGACAACCATTTGAGGTATACTGG
CACCGAGCCCGAGTTCAAGAAGAAGCCGCCAAAGAGCAGGAATGGTATGATAACCGGCGG
ACCCACAGACAGCGCCATCGAGGTCGAGGAGCTGGCGCAGGATATTAGATATCCGAAGGA
CGTTGACACATTGGCCACCAGAGTGACCAGCGCCAGGCAGTTGAAGAAGTGCAGCACTCC
GGCCCGCAGTCCGATCATCGGATAGGCAATCGCCGTGAAGACCAGTGGCACTGTGAGAAA
AAGCGGCAATTCGGCAATCGTTTTGCCCAGAAAGTATGTGTCACAGCGATAAAGTCGACT
TCGGGCCTCCCTCATAAAAACTGGCAGCTCTGAGGTGAACACCTAAATCGAATCGATTCA
TTAGAAAGTTAGTAAATTATTGAAATGCAAATGTATTCTAAACATGACTTACATTTATCG
TGGCAAAGACGTTTTGAAAGGTCATGTTGGTCAGGAAGAGGAAGATGGCTCCGTTGATAT
TCATCACACCCACTTGCGTGAGTTGTTGGCCCAAAAAGATGAGGCCAATCAAGATGGCAA
CCATCTGCAAATTAAAATGTTACTCGCATCTCATTAATATTCGCGAGTTAAATGAAATTT
ATTTATCTTCTGCAAAACTATAAACTATACATCTCATTGAAAAAAACTAAGAAGGGTGTG
GAATCAGGCAATTCTATCTAAAATCTAGCGAATTTGTTTCCAAGAATTGTAAGCGTTATA
TCATTTGTTTCCACTGGAACCACTCACCGTTGTCTGAATAAGTCGCACTTTTACGAGGAG
TGGTTCCTTGAGCACCGACAGCCAGGATCGCCACAGGACCGCCCGGAACTGCATGAACCA
GGTGGCCTTGTAGGTGTACCCATTCTCCGGCTGCTCCAGTGGCTTCTCCAGATTTTTGGT
GGCCAACAACTGCTCCATATCCCGGGCTACTTTGCTAATGGCAAAATTGTCGCATATCTT
GGCGATCCGATCACGGGACTCGATCTCCCGTCCGGGCACAACGGCCAACACCTGTACGTA
AAAGTCCGCCGGATTGTAGTTGGTAGGACACTGGGCACCCACGCTGGATAGGAGTTGAGA
TGTTATGTAATACTAGATACCCTTAATAAACACATCGAACTCACTAGGAAAAGAAGTCGA
CGGCTTCGCTGGGAGTGCCCAAGAAAGCTACCCTGCCCTCGGCCATCAGAAGGATCTTGT
CAAAGAGCTCAAACAGCTCGGAAGACGGCTGATGAATGGTCAGGATGACGGTCTTGCCCT
TCTGCGACAGCTTCTTCAGCACCTGGACGACGCTGTGGGCGGTAAAGGAGTCCAGTCCGG
AGGTGGGCTCATCGCAGATCAGAAGCGGCGGATCGGTTAGAGCCTCGGAGGCGAATGCCA
GACGCTTCCTTTCTCCGCCGGACAGACCTTTCACCCTGCCGGGCACACCGATGATCGTGT
GCTGACATTTGCTGAGCGAAAGCTCCTGGATCACCTGATCCACGCGGGCCACTCGCTGCC
GATAGGTCAGATGTCGTGGCATCCGCACCATGGCTTGGAAAATCAGGTGTTCCCTGGCCG
TTAGGGAGCCGATAAAGAGGTCATCCTGCTGGACATAGGCGCACCTGGCCTGCATCTCCT
TGGCGTCCACAGGTTGGCCATTGAGCAGTCGCATCCCGGATGGCGATACTTGGATGCCCT
GCGGCGATCGAAAGGCAAGGGCATTCAGCAGGGTCGTCTTTCCGGCACCGGAACTGCCCA
TCACGGCCAAAAGTTCGCCCGGATAGGCCACGCCGCAAACTGAGTTTCAAATTGGTAATT
GGACCCTTTATTAAGATTTCACACAGATCAGCCGACTGCGAATAGAAACTCACCGTTCTT
GAGCAAATGTTTCCTGGGCGCCGGTATGTGTCGCTCGTTGCAGAATAGTCCGCGTGTCCG
GTTGACCAGCTGCCGCCATCCGGAGCCCGGCTGATTGACCGCCCCAAAGATGTCCATATT
GTGCCAGGCATAGGTGAGGTTCTCGGCTAGTTGGCCGCTCCCTGAACCGGAGTCCTCCGG
CGGACTGGGTGGCCGGAGCGTGCCGTAGTTTTTGGCCTGCCCGAAGCCCTGGTTAATGCA
GCTCTGCGAAGCCGCTCCGCTGTCACCCTGCAATGATAGGGGATCTCAAATATCAACTAC
TAGCGTTATGCTCATCTAACCCCGAACAAAAAGTACCCCGAAGTATCCTACGAAGTAGGT
TTATACTTTTATTTATTTTTTGTGCATCTAGGATCAGCTTAAAATATCTGGTTGTTATAT
TTTTTGTAAAAAAGAATATAGTCGAAAATGAATGCCTTTAGATGTCTTGATCATGATATG
ATCTCAAAAATTGTCTTATATAGCGAGAACAGCTACCAGAATAATCTGTTTCGTGTCACT
ATTTGTTTGTGCAATTGCGGTTTGGGATTTTTGTGGGTCGCAGTTCTCACGCCGCATACA
ATTTGATGTTGCAATCGCAGTTCCTATAGATCAAGTGAACTTAAGATGTATGCACATGTA
CTACTCACATTGTTCAGATGCTCGGCAGATGGGTGTTTGCTGCCTCCGCGAATTAATAGC
TCCTGATCCTCTTGGCCCATTGCCGGGATTTTTCACACTTTCCCCTGCTTACCCACCCAA
AACCAATCACCACCCCAATCACTCAAAAAACAAACAAAAATAAGAAGCGAGAGGAGTTTT
GGCACAGCACTTTGTGTTTAATTGATGGCGTAAACCGCTTGGAGCTTCGTCACGAAACCG
CTGACAAAATGCAACTGAAGGCGGACATTGACGCTACGTAACGCTACAAACGGTGGCGAA
AGAGATAGCGGACGCAGCGGCGAAAGAGACGGCGATATTTCTGTGGACAGAGAAGGAGGC
AAACAGCGCTGACTTTGAGTGGAATGTCATTTTGAGTGAGAGGTAATCGAAAGAACCTGG
TACATCAAATACCCTTGGATCGAAGTAAATTTAAAACTGATCAGATAAGTTCAATGATAT
CCAGTGCAGTAAAAAAAAAAAATGTTTTTTTTATCTACTTTCCGCAAAAATGGGTTTTAT
TAACTTACATACATACTAGGCGCGCCCATATGTTCGGCTTGTCGACATGCCCGCCGTGAC
CGTCGAGAACCCGCTGACGCTGCCCCGCGTATCCGCACCCGCCGACGCCGTCGCACGTCC
CGTGCTCACCGTGACCACCGCGCCCAGCGGTTTCGAGGGCGAGGGCTTCCCGGTGCGCCG
CGCGTTCGCCGGGATCAACTACCGCCACCTCGACCCGTTCATCATGATGGACCAGATGGG
TGAGGTGGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCACCGCGGCTT
CGAGACCGTGACCTACATCGTCGACGGTAACATGTGAGCAAAAGGCCAGCAAAAGGCCAG
GAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCA
TCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCA
GGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGG
ATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAG
GTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGT
TCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACA
CGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGG
CGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATT
TGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATC
CGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCG
CAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTG
GAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTA
GATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTG
GTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCG
TTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACC
ATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATC
AGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGC
CTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAG
TTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTAT
GGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTG
CAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGT
GTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAG
ATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCG
ACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTT
AAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCT
GTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTAC
TTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAAT
AAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCAT
TTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACA
AATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC

>pDest17-BD, 4826 bases.
TAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCT
CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGCGTAGCAGCCATCACC
ACCATCACCATCTCGAGATAACTTCGTATAGCATACATTATACGAAGTTATAGATCCAAT
ATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTT
AGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTGC
GGCCGCACAAAGTGGTTGATTCGAGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGC
TGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAG
GGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATATCCACAGGACGGGTGTGGTCGCCA
TGATCGCGTAGTCGATAGTGGCTCCAAGTAGCGAAGCGAGCAGGACTGGGCGGCGGCCAA
AGCGGTCGGACAGTGCTCCGAGAACGGGTGCGCATAGAAATTGCATCAACGCATATAGCG
CTAGCAGCACGCCATAGTGACTGGCGATGCTGTCGGAATGGACGATATCCCGCAAGAGGC
CCGGCAGTACCGGCATAACCAAGCCTATGCCTACAGCATCCAGGGTGACGGTGCCGAGGA
TGACGATGAGCGCATTGTTAGATTTCATACACGGTGCCTGACTGCGTTAGCAATTTAACT
GTGATAAACTACCGCATTAAAGCTTATCGATGATAAGCTGTCAAACATGAGAATTCTTGA
AGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTT
TCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTT
TTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAA
TAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTT
TTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGAT
GCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAG
ATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTG
CTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATA
CACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGAT
GGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCC
AACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATG
GGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAAC
GACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACT
GGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAA
GTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCT
GGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCC
TCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGA
CAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTAC
TCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAG
ATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCG
TCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATC
TGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAG
CTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTC
CTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATAC
CTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACC
GGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGT
TCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGT
GAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGC
GGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTT
TATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCA
GGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTT
TGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGT
ATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAG
TCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGC
GGTATTTCACACCGCATATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGT
TAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCC
GCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACA
AGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACG
CGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGAAGCGATTCACAGATGTCTGC
CTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGAT
AAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTGGTCACTGATGCCTCCGTGTAAGG
GGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGATACG
GGTTACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGT
ATGGATGCGGCGGGACCAGAGAAAAATCACTCAGGGTCAATGCCAGCGCTTCGTTAATAC
AGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCCTGCGATGCAGATCCGGAACATAAT
GGTGCAGGGCGCTGACTTCCGCGTTTCCAGACTTTACGAAACACGGAAACCGAAGACCAT
TCATGTTGTTGCTCAGGTCGCAGACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCGCG
TATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAGCCTAGCCGGGTCCTCAA
CGACAGGAGCACGATCATGCGCACCCGTGGCCAGGACCCAACGCTGCCCGAGATGCGCCG
CGTGCGGCTGCTGGAGATGGCGGACGCGATGGATATGTTCTGCCAAGGGTTGGTTTGCGC
ATTCACAGTTCTCCGCAAGAATTGATTGGCTCCAATTCTTGGAGTGGTGAATCCGTTAGC
GAGGTGCCGCCGGCTTCCATTCAGGTCGAGGTGGCCCGGCTCCATGCACCGCGACGCAAC
GCGGGGAGGCAGACAAGGTATAGGGCGGCGCCTACAATCCATGCCAACCCGTTCCATGTG
CTCGCCGAGGCGGCATAAATCGCCGTGACGATCAGCGGTCCAGTGATCGAAGTTAGGCTG
GTAAGAGCCGCGAGCGATCCTTGAAGCTGTCCCTGATGGTCGTCATCTACCTGCCTGGAC
AGCATGGCCTGCAACGCGGGCATCCCGATGCCGCCGGAAGCGAGAAGAATCATAATGGGG
AAGGCCATCCAGCCTCGCGTCGCGAACGCCAGCAAGACGTAGCCCAGCGCGTCGGCCGCC
ATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGGTGGCGGGACCAGTGACGAAG
GCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCG
CTCCAGCGAAAGCGGTCCTCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACG
AGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCATGCCCCGCGCCCAC
CGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGATCGACGCTCTCCCTT
ATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGC
CGCAAGGAATGGTGCATGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGC
CACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCC
ATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGC
CACGATGCGTCCGGCGTAGAGGATCG

>pET44a-BD, 7133 bases.
TGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCG
CAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTC
CTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGG
GTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTC
ACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTT
CTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTC
TTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTA
ACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCTGGCGGCACGAT
GGCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTT
AAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGT
GAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTC
GTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCG
CGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCC
GAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGG
GAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACA
GGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGA
TCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCT
CCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTG
CATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCA
ACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATA
CGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCT
TCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACT
CGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAA
ACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTC
ATACTCTTCCTTTTTCAATCATGATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGG
ATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGTCATGACCAAAATCCCTTAAC
GTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAG
ATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGG
TGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCA
GAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGA
ACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCA
GTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGC
AGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACA
CCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAA
AGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTC
CAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGC
GTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGG
CCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTAT
CCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCA
GCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGT
ATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATATGGTGCACTCTCAGTAC
AATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGG
GTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTG
CTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGG
TTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTCG
TGAAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGA
AGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTG
GTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAA
CGAGAGAGGATGCTCACGATACGGGTTACTGATGATGAACATGCCCGGTTACTGGAACGT
TGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAATCACTCAGGGT
CAATGCCAGCGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCCT
GCGATGCAGATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGCGTTTCCAGACTTTAC
GAAACACGGAAACCGAAGACCATTCATGTTGTTGCTCAGGTCGCAGACGTTTTGCAGCAG
CAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCC
CGCCAGCCTAGCCGGGTCCTCAACGACAGGAGCACGATCATGCTAGTCATGCCCCGCGCC
CACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCC
TAATGAGTGAGCTAACTTACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGA
AACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGT
ATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTT
CACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCG
AAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTC
GTATCCCACTACCGAGATGTCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCAT
TGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATT
CAGCATTTGCATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGC
TATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGC
CGAGACAGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAG
ATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGGTGT
CTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAAT
GGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAAG
ATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCAC
GCTGGCACCCAGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTG
CAGGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTG
TGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACTTTTTCCCGCGT
TTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAGAGACACC
GGCATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACT
CTCTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGG
GATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGA
GGCCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGCAAGGAGATGGCGCCCAACAGTC
CCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGT
GGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTG
TGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGATCGATCTCGATC
CCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAG
AAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGGCAGCAGCCATCACCACCA
TCACCATTCTAGTATGAACAAAGAAATTTTGGCTGTAGTTGAAGCCGTATCCAATGAAAA
GGCGCTACCTCGCGAGAAGATTTTCGAAGCATTGGAAAGCGCGCTGGCGACAGCAACAAA
GAAAAAATATGAACAAGAGATCGACGTCCGCGTACAGATCGATCGCAAAAGCGGTGATTT
TGACACTTTCCGTCGCTGGTTAGTTGTTGATGAAGTCACCCAGCCGACCAAGGAAATCAC
CCTTGAAGCCGCACGTTATGAAGATGAAAGCCTGAACCTGGGCGATTACGTTGAAGATCA
GATTGAGTCTGTTACCTTTGACCGTATCACTACCCAGACGGCAAAACAGGTTATCGTGCA
GAAAGTGCGTGAAGCCGAACGTGCGATGGTGGTTGATCAGTTCCGTGAACACGAAGGTGA
AATCATCACCGGCGTGGTGAAAAAAGTAAACCGCGACAACATCTCTCTGGATCTGGGCAA
CAACGCTGAAGCCGTGATCCTGCGCGAAGATATGCTGCCGCGTGAAAACTTCCGCCCTGG
CGACCGCGTTCGTGGCGTGCTCTATTCCGTTCGCCCGGAAGCGCGTGGCGCGCAACTGTT
CGTCACTCGTTCCAAGCCGGAAATGCTGATCGAACTGTTCCGTATTGAAGTGCCAGAAAT
CGGCGAAGAAGTGATTGAAATTAAAGCAGCGGCTCGCGATCCGGGTTCTCGTGCGAAAAT
CGCGGTGAAAACCAACGATAAACGTATCGATCCGGTAGGTGCTTGCGTAGGTATGCGTGG
CGCGCGTGTTCAGGCGGTGTCTACTGAACTGGGTGGCGAGCGTATCGATATCGTCCTGTG
GGATGATAACCCGGCGCAGTTCGTGATTAACGCAATGGCACCGGCAGACGTTGCTTCTAT
CGTGGTGGATGAAGATAAACACACCATGGACATCGCCGTTGAAGCCGGTAATCTGGCGCA
GGCGATTGGCCGTAACGGTCAGAACGTGCGTCTGGCTTCGCAACTGAGCGGTTGGGAACT
CAACGTGATGACCGTTGACGACCTGCAAGCTAAGCATCAGGCGGAAGCGCACGCAGCGAT
CGACACCTTCACCAAATATCTCGACATCGACGAAGACTTCGCGACTGTTCTGGTAGAAGA
AGGCTTCTCGACGCTGGAAGAATTGGCCTATGTGCCGATGAAAGAGCTGTTGGAAATCGA
AGGCCTTGATGAGCCGACCGTTGAAGCACTGCGCGAGCGTGCTAAAAATGCACTGGCCAC
CATTGCACAGGCCCAGGAAGAAAGCCTCGGTGATAACAAACCGGCTGACGATCTGCTGAA
CCTTGAAGGGGTAGATCGTGATTTGGCATTCAAACTGGCCGCCCGTGGCGTTTGTACGCT
GGAAGATCTCGCCGAACAGGGCATTGATGATCTGGCTGATATCGAAGGGTTGACCGACGA
AAAAGCCGGAGCACTGATTATGGCTGCCCGTAATATTTGCTGGTTCGGTGACGAAGCGAC
TAGTATAACTTCGTATAGCATACATTATACGAAGTTATAGATCCAATATTATTGAAGCAT
TTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACA
AATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCCTAGGCTGATAAAA
CAGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAA
GTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGC
CAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTG
TTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGC
GAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAAT
TAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTGTTTAT
TTTTCTAAATACATTCAAATATGTATCCGCTGAGCAATAACTAGCATAACCCCTTGGGGC
CTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGAT

>pUAST-CFH-BDattB sequence 8042 bp
TAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCGTTTA
AACGGCCGGCCAGATCTGGTACCGGATCCAAGCTTGCATGCCTGCAGGTCGGAGTACTGTCCTCCGAGCGGAGTACTGTC
CTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGTACTGTCCTCCGAGCGGAGACTCTAGCGAG
CGCCGGAGTATAAATAGAGGCGCTTCGTCTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAGCG
AAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCTGCAGTAAAGTGCAAGTTAAAGTGAATCAATTAAA
AGTAACCAGCAACCAAGTAAATCAACTGCAACTACTGAAATCTGCCAAGAAGTAATTATTGAATACAAGAAGAGAACTCT
GAATAGGGAATTGGGAATTCGTTAACAGATCTGCggccgcataacttcgtatagcatacattatacgaagttatagatcc
aatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaata
ggggttccgcgcacatttccccgaaaagtgccacctgacgtggatctcgagctcaagcttcgaattcagggtttccttga
caatatcatacttatcctgtcccttttttttccacagctaccggtcgcgtctagaGACTACAAAGACGATGACGACAAGG
TCAAACTTTACCCATACGATGTTCCAGATTACGCTGCTGCTtagtCTAGAGGATCTTTGTGAAGGAACCTTACTTCTGTG
GTGTGACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTT
AAACTACTGATTCTAATTGTTTGTGTATTTTAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGTGGAATGCCTT
TAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGATGATGAGGCTACTGCTGACTCTCAACATTCTACTC
CTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAAGGACTTTCCTTCAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTT
AGTAATAGAACTCTTGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGCACTGCTATACAAGAAAATTATGGAAAA
ATATTTGATGTATAGTGCCTTGACTAGAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAAC
CTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGG
TTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAAC
TCATCAATGTATCTTATCATGTCTGGATCCCCGCGCGGCCGCTGGCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGG
ACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTG
CTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGGAAGT
CAGCGCCCTGCACCATTATGTTCCGGAGGCGCGCCCTAGTTCCAGTGAAATCCAAGCATTTTCTAAATTAAATGTATTCT
TATTATTATAGTTGTTATTTTTGATATATATAAACAACACTATTATGCCCACCATTTTTTTGAGATGCATCTACACAAGG
AACAAACACTGGATGTCACTTTCAGTTCAAATTGTAACGCTAATCACTCCGAACAGGTCACAAAAAATTACCTTAAAAAG
TCATAATATTAAATTAGAATAAATATAGCTGTGAGGGAAATATATACAAATATATTGGAGCAAATAAATTGTACATACAA
ATATTTATTACTAATTTCTATTGAGACGAAATGAACCACTCGGAACCATTTGAGCGAACCGAATCGCGCGGAACTAACGA
CAGTCGCTCCAAGGTCGTCGAACAAAAGGTGAATGTGTTGCGGAGAGCGGGTGGGAGACAGCGAAAGAGCAACTACGAAA
CGTGGTGTGGTGGAGGTGAATTATGAAGAGGGCGCGCGATTTGAAAAGTATGTATATAAAAAATATATCCCGGTGTTTTA
TGTAGCGATAAACGAGTTTTTGATGTAAGGTATGCAGGTGTGTAAGTCTTTTGGTTAGAAGACAAATCCAAAGTCTACTT
GTGGGGATGTTCGAAGGGGAAATACTTGTATTCTATAGGTCATATCTTGTTTTTATTGGCACAAATATAATTACATTAGC
TTTTTGAGGGGGCAATAAACAGTAAACACGATGGTAATAATGGTAAAAAAAAAAAACAAGCAGTTATTTCGGATATATGT
CGGCTACTCCTTGCGTCGGGCCCGAAGTCTTAGAGCCAGATATGCGAGCACCCGGAAGCTCACGATGAGAATGGCCAGAC
CCACGTAGTCCAGCGGCAGATCGGCGGCGGAGAAGTTAAGCGTCTCCAGGATGACCTTGCCCGAACTGGGGCACGTGGTG
TTCGACGATGTGCAGCTAATTTCGCCCGGCTCCACGTCCGCCCATTGGTTAATCAGCAGACCCTCGTTGGCGTAACGGAA
CCATGAGAGGTACGACAACCATTTGAGGTATACTGGCACCGAGCCCGAGTTCAAGAAGAAGCCGCCAAAGAGCAGGAATG
GTATGATAACCGGCGGACCCACAGACAGCGCCATCGAGGTCGAGGAGCTGGCGCAGGATATTAGATATCCGAAGGACGTT
GACACATTGGCCACCAGAGTGACCAGCGCCAGGCAGTTGAAGAAGTGCAGCACTCCGGCCCGCAGTCCGATCATCGGATA
GGCAATCGCCGTGAAGACCAGTGGCACTGTGAGAAAAAGCGGCAATTCGGCAATCGTTTTGCCCAGAAAGTATGTGTCAC
AGCGATAAAGTCGACTTCGGGCCTCCCTCATAAAAACTGGCAGCTCTGAGGTGAACACCTAAATCGAATCGATTCATTAG
AAAGTTAGTAAATTATTGAAATGCAAATGTATTCTAAACATGACTTACATTTATCGTGGCAAAGACGTTTTGAAAGGTCA
TGTTGGTCAGGAAGAGGAAGATGGCTCCGTTGATATTCATCACACCCACTTGCGTGAGTTGTTGGCCCAAAAAGATGAGG
CCAATCAAGATGGCAACCATCTGCAAATTAAAATGTTACTCGCATCTCATTAATATTCGCGAGTTAAATGAAATTTATTT
ATCTTCTGCAAAACTATAAACTATACATCTCATTGAAAAAAACTAAGAAGGGTGTGGAATCAGGCAATTCTATCTAAAAT
CTAGCGAATTTGTTTCCAAGAATTGTAAGCGTTATATCATTTGTTTCCACTGGAACCACTCACCGTTGTCTGAATAAGTC
GCACTTTTACGAGGAGTGGTTCCTTGAGCACCGACAGCCAGGATCGCCACAGGACCGCCCGGAACTGCATGAACCAGGTG
GCCTTGTAGGTGTACCCATTCTCCGGCTGCTCCAGTGGCTTCTCCAGATTTTTGGTGGCCAACAACTGCTCCATATCCCG
GGCTACTTTGCTAATGGCAAAATTGTCGCATATCTTGGCGATCCGATCACGGGACTCGATCTCCCGTCCGGGCACAACGG
CCAACACCTGTACGTAAAAGTCCGCCGGATTGTAGTTGGTAGGACACTGGGCACCCACGCTGGATAGGAGTTGAGATGTT
ATGTAATACTAGATACCCTTAATAAACACATCGAACTCACTAGGAAAAGAAGTCGACGGCTTCGCTGGGAGTGCCCAAGA
AAGCTACCCTGCCCTCGGCCATCAGAAGGATCTTGTCAAAGAGCTCAAACAGCTCGGAAGACGGCTGATGAATGGTCAGG
ATGACGGTCTTGCCCTTCTGCGACAGCTTCTTCAGCACCTGGACGACGCTGTGGGCGGTAAAGGAGTCCAGTCCGGAGGT
GGGCTCATCGCAGATCAGAAGCGGCGGATCGGTTAGAGCCTCGGAGGCGAATGCCAGACGCTTCCTTTCTCCGCCGGACA
GACCTTTCACCCTGCCGGGCACACCGATGATCGTGTGCTGACATTTGCTGAGCGAAAGCTCCTGGATCACCTGATCCACG
CGGGCCACTCGCTGCCGATAGGTCAGATGTCGTGGCATCCGCACCATGGCTTGGAAAATCAGGTGTTCCCTGGCCGTTAG
GGAGCCGATAAAGAGGTCATCCTGCTGGACATAGGCGCACCTGGCCTGCATCTCCTTGGCGTCCACAGGTTGGCCATTGA
GCAGTCGCATCCCGGATGGCGATACTTGGATGCCCTGCGGCGATCGAAAGGCAAGGGCATTCAGCAGGGTCGTCTTTCCG
GCACCGGAACTGCCCATCACGGCCAAAAGTTCGCCCGGATAGGCCACGCCGCAAACTGAGTTTCAAATTGGTAATTGGAC
CCTTTATTAAGATTTCACACAGATCAGCCGACTGCGAATAGAAACTCACCGTTCTTGAGCAAATGTTTCCTGGGCGCCGG
TATGTGTCGCTCGTTGCAGAATAGTCCGCGTGTCCGGTTGACCAGCTGCCGCCATCCGGAGCCCGGCTGATTGACCGCCC
CAAAGATGTCCATATTGTGCCAGGCATAGGTGAGGTTCTCGGCTAGTTGGCCGCTCCCTGAACCGGAGTCCTCCGGCGGA
CTGGGTGGCCGGAGCGTGCCGTAGTTTTTGGCCTGCCCGAAGCCCTGGTTAATGCAGCTCTGCGAAGCCGCTCCGCTGTC
ACCCTGCAATGATAGGGGATCTCAAATATCAACTACTAGCGTTATGCTCATCTAACCCCGAACAAAAAGTACCCCGAAGT
ATCCTACGAAGTAGGTTTATACTTTTATTTATTTTTTGTGCATCTAGGATCAGCTTAAAATATCTGGTTGTTATATTTTT
TGTAAAAAAGAATATAGTCGAAAATGAATGCCTTTAGATGTCTTGATCATGATATGATCTCAAAAATTGTCTTATATAGC
GAGAACAGCTACCAGAATAATCTGTTTCGTGTCACTATTTGTTTGTGCAATTGCGGTTTGGGATTTTTGTGGGTCGCAGT
TCTCACGCCGCATACAATTTGATGTTGCAATCGCAGTTCCTATAGATCAAGTGAACTTAAGATGTATGCACATGTACTAC
TCACATTGTTCAGATGCTCGGCAGATGGGTGTTTGCTGCCTCCGCGAATTAATAGCTCCTGATCCTCTTGGCCCATTGCC
GGGATTTTTCACACTTTCCCCTGCTTACCCACCCAAAACCAATCACCACCCCAATCACTCAAAAAACAAACAAAAATAAG
AAGCGAGAGGAGTTTTGGCACAGCACTTTGTGTTTAATTGATGGCGTAAACCGCTTGGAGCTTCGTCACGAAACCGCTGA
CAAAATGCAACTGAAGGCGGACATTGACGCTACGTAACGCTACAAACGGTGGCGAAAGAGATAGCGGACGCAGCGGCGAA
AGAGACGGCGATATTTCTGTGGACAGAGAAGGAGGCAAACAGCGCTGACTTTGAGTGGAATGTCATTTTGAGTGAGAGGT
AATCGAAAGAACCTGGTACATCAAATACCCTTGGATCGAAGTAAATTTAAAACTGATCAGATAAGTTCAATGATATCCAG
TGCAGTAAAAAAAAAAAATGTTTTTTTTATCTACTTTCCGCAAAAATGGGTTTTATTAACTTACATACATACTAGGCGCG
CCCATATGTTCGGCTTGTCGACATGCCCGCCGTGACCGTCGAGAACCCGCTGACGCTGCCCCGCGTATCCGCACCCGCCG
ACGCCGTCGCACGTCCCGTGCTCACCGTGACCACCGCGCCCAGCGGTTTCGAGGGCGAGGGCTTCCCGGTGCGCCGCGCG
TTCGCCGGGATCAACTACCGCCACCTCGACCCGTTCATCATGATGGACCAGATGGGTGAGGTGGAGTACGCGCCCGGGGA
GCCCAAGGGCACGCCCTGGCACCCGCACCGCGGCTTCGAGACCGTGACCTACATCGTCGACGGTAACATGTGAGCAAAAG
GCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCAC
AAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCT
CGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTC
ATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAG
CCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGC
CACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACA
CTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGC
AAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGA
TCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAA
AAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCT
GACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCC
CGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCAC
CGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCC
ATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGC
TACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACAT
GATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTA
TCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTA
CTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGC
CACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTG
AGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGC
AAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTC
AATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATA
GGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGAGTC