[an error occurred while processing this directive] BDGP: PCR Amplification of D. melanogaster UniGene Collection

BDGP Resources

PCR Amplification of D. melanogaster UniGene Collection

Using plasmid DNA as template (Pavel Tomancak 8.15.2000)

  1. 5µ of DNA template purified using Qiagen 96-well Turbo kit on a Qiagen BioRobot 9600 were diluted with 150 µ of ddH20 to achieve final concentration in a 1-10 ng/µ range.

(Both the concentrated and the diluted templates were covered with Scotch Pad sealing tape and stored at -20 C. Before use, the plates were thawed and briefly centrifuged so as to remove any water that had condensed on the sealing tape.)

  1. 5µ of diluted DNA template were transferred to a 96-well PCR plate (Applied Scientific #AS-2065).

  2. Up to 400x PCR master mix was prepared on ice and aliquotted on top of the template DNA using a multichannel pipettor (no mixing necessary).

[PCR primers OTf and OTr (White, KP et al., Science 1999, 286(5447):2179-84) were synthetised by Operon - 1.0 mmol scale; no purification]

PCR reaction conditions for cDNAs in size categories 1 and 2:

For cDNAs in size categories 1 and 2, a 100 µ amplification reaction using standard Taq polymerase (Amersham #27-0799-03) was used.

1x PCR coctail:

        10 µ         10x PCR buffer (Amersham #27-0799-03)         
        1.0 µ        dNTP mix (20 mM each Amersham #27-2035-01)            
        0.5 µ        pOTf (0.4 µ/µ 5' AATGCAGGTTAACCTGGCTTATCG 3')               
        0.5 µ        pOTr (0.4 µ/µ 5' AACGCGGCTACAATTAATACATAACC 3')
        0.375 µ    Amersham Taq (5U/µ Amersham #27-0799-03)              
        82.625 µ   ddH20
        ----------------
        95.0 µ

Thermal cycling was performed on PE GeneAmp PCR system 9700 under the following conditions:

        Size 1 Templates        Size 2 Templates

        1x      94 C    4 min.  1x      94 C    4 min.
        35x     94 C    30 sec. 35x     94 C    30 sec.
                57 C    30 sec.         57 C    30 sec.
                72 C    4 min.          72 C    6 min.
        1x      72 C    5 min.  1x      72 C    7 min. 
        4 C     hold            4 C     hold

One-twentieth of each reaction was analyzed by agarose gel electrophoresis. On average, 92 % of PCR reactions produced a satisfactory single strong PCR product. Templates that failed to amplify altogether and templates that produced weak, smeared, or multiple bands were manually re-arrayed into a new plate and amplified using Herculase polymerase.

PCR reaction conditions for cDNAs in size categories 3 and 4:

For cDNAs in size categories 3 and 4, [as well as Full Length Sequenced (FLS) clones and failed samples from size 1 and 2] a 20 µ amlification reaction using Herculase polymerase (Stratagene #600264) was performed.

1x PCR coctail:

        2.0 µ      10x Herculase PCR buffer (Stratagene #600264)           
        0.2 µ      dNTP mix (20 mM each Amersham #27-2035-01)          
        0.1 µ      pOTf (0.4 µ/µ 5' AATGCAGGTTAACCTGGCTTATCG 3')         
        0.1 µ      pOTr (0.4 µ/µ 5' AACGCGGCTACAATTAATACATAACC 3')
        0.2 µ      Herculase (5U/µ Stratagene #600264)            
        12.4 µ     ddH20
        -------------
        15.0 µ

Thermal cycling was performed on PE GeneAmp PCR system 9700 under the following conditions: Size 1 & 2 re-amplification FLS & Size 3 Templates Size 4 Templates

        1x      92 C    4 min.  1x      92 C    4 min.  1x      92 C    4 min.
        35x     92 C    30 sec. 35x     92 C    30 sec. 35x     92 C    30 sec. 
                57 C    30 sec.         57 C    30 sec.         57 C    30 sec.
                72 C    6 min.          72 C    7 min.          72 C    8 min.
        1x      72 C    7 min.  1x      72 C    8 min.  1x      72 C    9 min.  
                4 C     hold            4 C     hold            4 C     hold

Reactions were diluted with ddH20 to 50 µ One-twentieth of this dilution was analyzed by agarose gel electrophoresis. The yields of the 20 µ Herculase PCR reactions were about half that of the 100 µ Amersham Taq PCR reactions. Approximately 95% of the PCR reactions produced a satisfactory product, however the frequency of multiple bands was higher for size categories 3 and 4 than it was for size categories 1 and 2.