[an error occurred while processing this directive] BDGP: Sizing cDNA PCR products

BDGP Resources

Sizing cDNA PCR products

Reagents for one 8uL Rxn:

        10X Advantage Buffer    0.63uL
        10 mM dNTPS             0.135uL
        20uM primer1            0.10125uL
        20uM primer2            0.10125uL
        Advantage Taq (5U/uL)   0.045uL
        ddH2O                   3.9875uL
        Template                3.0uL from 3:150 dilution in H2O from
                                Original bacterial cDNA frozen stock plate

Use the following primer pairs:

 0T2a vector:
PM001a          5' GTCGACGTTAGAACGCGGCTAC 3'
PM002a          5' GGGTTAAATTCCCGGGTACTGC 3'

 BS vector:
SK-30           5' GGGTAACGCCAGGGTTTTCC 3'
SKMet           5' ATGACCATGATTACGCCAAGC 3'

Advantage Buffer and cDNA Polymerase Mix (#8417-1) are available from Clontech Laboratories, Inc. We have also successfully used DyNAzyme EXT Polymerase (F-505L) and EXT Buffer with Mg2+ (F-514L) available from Finnzymes and MJ Research, Inc. If DyNAzyme is used, please change the extension temperatures in the PCR profile to 72 C instead of 68 C.


PCR profile:

        95 C           1 min
        95 C           0.5min
        68 to 58 C     0.75min              Touchdown for 5 cycles
        68 C           3 min

        95 C           1 min
        58 C           0.75min             Auto extend for 28 cycles
        68 C           4 min + 0.1min

        68 C           10 min
        4 C            soak