BDGP Resources

pOT2 Vector

The SP6 primer does not work well for sequencing, so we use the PM001 primer for 3' EST sequencing, and the T7 primer for 5' EST sequencing.

T7 primer: AAT ACG ACT CAC TAT AGG
PM001 primer: CGT TAG AAC GCG GCT ACA AT

>gb||pOT2 pOT2 vector ORGANISM  pOT2 vector)
CGTTAGAACGCGGCTACAATTAATACATAACCTTATGTATCATACACATA
CGATTTAGGTGACACTATAGAACTCGAGCAGCTGAAGCTCCAATGTGATG
GTCTAGAGGATCCGAATTCCCAGCACAGTGGCGATGATATCAGATCTGCC
GGTCTCCCTATAGTGAGTCGTATTAATTTCGATAAGCCAGGTTAACCTGC
ATTAATGAATCGGCTGCAGTACCCGGGAATTTAACCCGCCTAATGAGCGG
GCTTTTTTTTGTGATCCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGC
GTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTG
TTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCA
GCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGC
CACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAAT
CCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGT
TGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACG
GGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACT
GAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGA
GAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGC
ACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGG
GTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGG
GGCGGAGCCTATGGAAAAACGCCAGCAACGCGGATCACAACAAAAAGCCC
GCTCATTAGGCGGGCTAAATTCTCATGTTTGACAGCTTATCATCGATAAG
CTTTAATGAGTTATCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGA
AAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAA
GAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGAC
CGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGC
ACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCT
CATCCGGAGTTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGA
TAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTT
CATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATA
TATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAA
AGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTT
TCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCC
GTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCC
GCTGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCA
GAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCG
TAATTGGTACGTCGA

EcoRI adapter sequence:
5'-GAATTCGGCACGAGG-3'