BDGP Resources

In-Fusion Protocol

v.08.08.05

Materials:

DpnI (20U/uL)

NEB #R0176L

10mM dNTP

NEB #N0447L

Finnzymes Phusion DNA Polymerase (2U/uL)

MJ Research #F-530L

TAM1 Competent Cells

Active Motif #11096

In-Fusion PCR Cloning Kit

BDBiosciences #631775

LB/Amp/X-Gal Plates

PCR Template

Inoculate 5uL cDNA clone from bacterial stock into 600uL LB/Antibiotic

Grow overnight @ 37C.

PCR Reaction

1:10 Cell Dilution in H2O 3.0uL

5X Phusion Buffer 4.0uL

10mM dNTP 0.4uL

5uM 5' BD Oligo 1.2uL

5uM 3' BD Oligo 1.2uL

Phusion Polymerase 0.15uL

dH2O 10.05uL

Total 20uL

98C 1 Min.

98C 10 Sec.

59C-->50C 30 Sec. 3 Cycles (Annealing temp. lowered 3C per cycle)

72C 2 Min.

98C 10 Sec.

50C 30 Sec. 13 Cycles

72C 2 Min.

72C 5 Min.

4C Forever

Analyze 5uL on 1% agarose gel.

NOTE: For PCR templates that carry the Ampicillin resistant gene, an enzymatic digestion of the template plasmid must be performed since the pDNR-Dual vector is also Amp^r. This eliminates the possibility of the originating parent plasmid from being carried over. This DpnI enzymatic step is not necessary for PCR templates carrying antibiotic resistant genes other than Amp and can be skipped.

DpnI Digest

PCR Products 15uL

NEB Buffer 4.2uL

DpnI 0.5uL

dH20 2.5uL

Total 20uL

37C 2 Hours

80C 20 Mins

G50 PCR Products

1. Add 300uL dH2O to hydrate G50.

2. Let plate sit at room temp for 3 hours.

3. Place hydrated G50 plate on top of Nunc plate fitted with the blue adapter to collect water.

4. Spin 950xG for 5 minutes.

5. Discard water.

6. Add additional 150uL dH2O to G50

7. Spin 950xG for 5 minutes.

8. Discard water.

9. Place G50 plate on top of a PCR plate (E&K #489096). No adapter necessary.

10. Place assembly on PCR plate base.

11. Transfer all of the PCR products into the G50 columns, being careful to aspirate the sample into the center of each column.

12. Spin 950xG for 5 minutes to collect sample in the PCR plate.

13. Should recover ~15-20uL of sample.

BD Reaction

G50'd PCR Product ~2.0 uL (~100ng/kb)

10X Infusion Reaction Buffer 1.0uL

10X BSA 1.0uL

pDNR-Dual Linearized Vector 0.5uL

Diluted Infusion Enzyme 0.5uL (stock is 10X, dilute to 1X with dilution buffer)

dH2O 5.0uL

Total 10ul

Incubate @25C 30 Mins (NOTE: For ORFs >3kb: incubate 37C for 15 Mins., then 50C for 15 Mins)

Add 20uL TE to BD reaction.

Store at -20C

Transformation

Thaw TAM1 cells on ice for 5 minutes

Add 1.5uL BD reaction to TAM1 cells

Tap cells gently to mix

Incubate on ice for 30 minutes

Heat shock cells at 42C for 30 seconds

Place cells back on ice for 2 minutes

Add 150uL SOC

Shake 37C at 250rpm for 40 min.

Plate all onto LB/Amp/X-Gal plates

Pick and Prep for end sequencing

Pick white colonies into 2XYT/Amp blocks

Grow overnight

Make frozen stock and spin down remainder for DNA mini-prep

Sequence 5' end with M13 forward primer: TGTAAAACGACGGCCAGT

Sequence 3' end with PDD3.1 primer: GTTTTTTATTGGTGAGAATCCAAGC